The characteristics of pulmonary fibrosis in a neonatal rat model of chronic hyperoxia lung injury
Original Article

The characteristics of pulmonary fibrosis in a neonatal rat model of chronic hyperoxia lung injury

Hanyu Wu1,2, Wei Shen1,2,3, Chao Chen1,2, Lin Yuan1,2

1Department of Neonatology, Children’s Hospital of Fudan University, National Children’s Medical Center, Shanghai, China; 2National Health Commission Key Laboratory of Neonatal Diseases, Shanghai, China; 3Xiamen Maternity and Child Care Hospital, Xiamen, China

Contributions: (I) Conception and design: H Wu, W Shen; (II) Administrative support: C Chen, L Yuan; (III) Provision of study materials or patients: C Chen; (IV) Collection and assembly of data: H Wu, W Shen; (V) Data analysis and interpretation: H Wu, W Shen, C Chen; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Lin Yuan, MD. Department of Neonatology, Children’s Hospital of Fudan University, 399 Wanyuan Road, Minhang District, Shanghai 201102, China; National Health Commission Key Laboratory of Neonatal Diseases, Shanghai, China. Email: drlynnyuan@163.com.

Background: Bronchopulmonary dysplasia (BPD) is a common respiratory complication in premature infants, in which pulmonary fibrosis will continue to lead to the long-term impairment of pulmonary function in children with BPD and seriously affect the quality of life. This study hopes to explore the changing trend of pulmonary fibrosis characteristics of chronic hyperoxia lung injury.

Methods: Newborn rats were randomly assigned to a room air (RA) group or a hyperoxia (HO) group and sampled at postnatal days (P) 3, 7, 14, 21, 28, and 42. Lung morphology was assessed using histological staining to evaluate alveolar development, collagen volume fraction (CVF), and myofibroblast distribution. Western blotting was used to measure protein expression levels of surfactant protein C (SPC), podoplanin (PDPN), cluster of differentiation 31 (CD31), and α-smooth muscle actin (α-SMA). Expression levels of fibrosis-related markers [α-SMA, Collagen I (Col I)] were evaluated at both protein and messenger ribonucleic acid (mRNA) levels using Western blot and quantitative real-time polymerase chain reaction (RT-qPCR), respectively. Additional RT-qPCR analysis was performed for fibronectin and connective tissue growth factor (CTGF).

Results: At P14, HO rats exhibited decreased radical alveolar count (RAC), increased mean linear intercept (MLI), and elevated CVF compared to RA rats. SPC, CD31, and PDPN protein levels were reduced, while α-SMA increased. Collagen deposition progressively increased, peaking at P42. Col I expression rose significantly at P21 and P42. Fibronectin mRNA peaked at P21, while CTGF mRNA increased from P7 and remained elevated through P21.

Conclusions: Pulmonary fibrosis in chronic hyperoxia-induced lung injury emerged by P14, peaked around P21, and stabilized thereafter. These findings offer insight into the temporal dynamics of fibrosis development in BPD and may help guide timing for therapeutic intervention.

Keywords: Bronchopulmonary dysplasia (BPD); chronic hyperoxia induced lung injury; pulmonary fibrosis; preterm


Submitted Aug 29, 2025. Accepted for publication Nov 20, 2025. Published online Dec 26, 2025.

doi: 10.21037/tp-2025-574


Highlight box

Key findings

• Pulmonary fibrosis in neonatal rats with chronic hyperoxia-induced lung injury emerges at postnatal day 14, peaks at day 21, and subsequently stabilized, highlighting a distinct temporal pattern of disease progression.

What is known and what is new?

• Pulmonary fibrosis is a critical but underexplored contributor to long-term pulmonary dysfunction in bronchopulmonary dysplasia (BPD).

• This study identifies the temporal progression of fibrosis in chronic hyperoxia-induced lung injury, thereby providing a new time-dependent perspective for understanding and targeting fibrosis in BPD.

What is the implication, and what should change now?

• The findings highlight that pulmonary fibrosis in BPD follows a distinct temporal pattern, with a critical peak period around postnatal day 21, suggesting that early intervention strategies should be precisely timed to prevent irreversible fibrosis and long-term lung dysfunction.


Introduction

Bronchopulmonary dysplasia (BPD) represents one of the most severe respiratory complications in premature infants, characterized by high mortality and significantly adverse effects on long-term development and prognosis (1). BPD primarily affects premature infants born before 32 weeks of gestation, with its incidence rising inversely with gestational age. Among extremely preterm infants born before 28 weeks, the incidence can reach to as high as 50% to 70% (2,3). In 1967, Northway et al. (4) first described the disease characterized by extensive pulmonary fibrosis in premature infants who had received mechanical ventilation, namely “classic” or “old” BPD. With the rapid development of neonatal rescue and mechanical ventilation technology, the survival rate of extremely premature infants has been significantly improved, and the pathological characteristics and manifestations of BPD have evolved. Researchers have proposed a “new” BPD distinguished by alveolar simplification and pulmonary vascular remodeling and mild pulmonary fibrosis (5).

The pathogenesis of BPD has not been fully clarified. It is generally agreed that premature infants suffer from repeated chronic inflammation and repair of immature lungs in response to hyperoxia, mechanical ventilation, infection and other injury factors. These processes disrupt normal lung development, resulting in alveolar development stagnation, pulmonary microvascular dysplasia and pulmonary interstitial fibrosis (6,7).

Although the “new” BPD is characterized by mild pulmonary fibrosis, its influence can persist into adulthood (8). Studies have shown that both BPD survivors may experience persistent lung dysfunction, which lasts until adulthood and does not seem to show significant catch-up growth (9). Galderisi et al. performed the lung function assessments of three teenagers with a history of BPD and revealed mild to moderate airflow restriction (10). Lung biopsy showed peribronchial fibrosis, submucosal thickening, basement membrane thickening and inflammatory cell infiltration, suggesting that the pulmonary fibrosis caused by BPD can last for a long time and is difficult to reverse. Furthermore, evidence indicates that preterm infants diagnosed with BPD face a significantly elevated risk of developing chronic respiratory conditions in adulthood, including persistent airway obstruction, asthma, emphysema, and chronic obstructive pulmonary disease (COPD), with ongoing impairment in lung function (8,11-13). Some scholars believe that BPD is the early origin of chronic lung disease (13,14). Understanding the mechanisms underlying pulmonary fibrosis in BPD is crucial for improving outcomes in premature infants and for enabling early prevention and intervention in adult respiratory disease. We present this article in accordance with the ARRIVE reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-574/rc).


Methods

Animal model and tissue preparation

Sprague-Dawley rats were purchased from Charles River (Zhejiang, China) and fed in Laboratory Animal Resources Center of Fudan University. The female rats (8–12 weeks) mated 3:1 with the male in the afternoon. Pregnant rats were randomly divided into room air (RA) group and hyperoxia group. A total of 12 litters of newborn pups were included in this study. The newborn pups were exposed to RA or 80%±5% O2 (HO) in a plastic hyperoxic chamber from postnatal day 0 (P0) to P14. An oxygen generator (Haier, China) was connected with the plastic chamber to continuous oxygen supply. Animals were raised at 22–27 ℃ with 50–70% humidity and subjected to a 12 hours light-dark cycle. Sodium lime and blue silica gels were placed in the hyperoxic chamber to adsorb carbon dioxide (CO2) and water vapour. Exchange HO female rats with RA and replace sodium lime and blue silica gel daily. An oxygen detector was used to detect the oxygen level of the chamber to maintain 80%±5% O2. After hyperoxia exposure, pups in HO group returned to RA and were fed until sacrificed. The rats were sacrificed at P3, P7, P14, P21, P28, P42 to harvest lung tissue. At the time of tissue harvest, mice were euthanized by 5% isoflurane inhalation. The right lung tissues were stored in −80 ℃ refrigerator for western blot and quantitative real-time polymerase chain reaction (RT-qPCR) analyses and the left lung tissues were perfused by trachea and fixed with 4% paraformaldehyde for paraffin embedding. All animal experiments were performed under a project license (No. 00076) granted by the Ethics Committee of Children’s Hospital of Fudan University, in compliance with National Institutes of Health Guide for the Care and Use of Laboratory Animals. A protocol was prepared before the study without registration.

Lung morphology and immunohistochemical staining

After dehydration and paraffin embedding, the lung tissues were cut into 4 µm sections and stained with hematoxylin and eosin (HE) and Masson’s trichrome. Collect image and calculate radical alveolar count (RAC) and mean linear intercept (MLI) to evaluate the alveolar development. Collagen volume fraction (CVF) was measured with FIJI to examine the percentage of collagen deposition per septal area and indicate the degree of fibrosis. Lung tissue paraffin sections were incubated with primary antibody [rabbit anti α-smooth muscle actin (α-SMA), 1:200, Servicebio, Wuhan, China] and secondary antibody [horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G, 1:500, Servicebio] after dewaxing and blocking. We conducted lung tissue α-SMA immunohistochemical staining to evaluate the positive area percentage of fibroblasts in lung tissue by FIJI.

Western blot

We compare the relative protein expression levels between RA and HO groups by sodium dodecyl sulfate-polyaclylarnide gel electrophoresis (SDS-PAGE). Proteins from lung tissues were extracted by Tissue-Protein Extraction Reagent (Thermofisher, Massachusetts, USA) mixed with Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermofisher). After electrophoresis, proteins were transferred to 0.45 µm nitrocellulose membrane (Merck Millipore, Darmstadt, Germany) which was then blocked and incubated with primary and secondary antibodies successively. The primary antibodies used in this study are as follows: rabbit anti-surfactant protein C (SPC) (1:1,000, Proteintech, Chicago, USA), rabbit anti-cluster of differentiation 31 (CD31) (1:1,000, Abcam, Cambridge, UK), mouse anti-podoplanin (PDPN) (1:500, Invitrogen, Carlsbad, USA), rabbit anti α-SMA (1:1,000, Cell Signal Technology, Danvers, USA), rabbit anti-Collagen I (Col I) (1:1,000, Abcam), rabbit anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000, Absin), rabbit anti-tubulin (1:5,000, Absin, Shanghai, China). The secondary antibodies used in the study are: HRP-conjugated goat anti-rabbit immunoglobulin G (1:5,000, Absin), HRP- conjugated goat anti-mouse immunoglobulin G (1:5,000, Absin).

RT-qPCR

RNA was extracted from lung tissues at P3, P7, P14, P21, P28, P42 using TRIzol Reagent (Invitrogen). Complementary deoxyribonucleic acid (cDNA) was synthesized following PrimeScript RT Reagent Kit (Takara, Tokyo, Japan) instructions. To quantify messenger ribonucleic acid (mRNA) relative expression, cDNA was amplified by RT-qPCR using the SYBR Premix Ex Taq RT-PCR Kit (Takara). To calculate gene expression fold changes using the 2−ΔΔCt method, actin served as the internal reference control. The primer sequences used in our study are shown in Table 1.

Table 1

Primer sequences used in this study

Gene 5'→3' sequences
Actin Forward: AGATGACCCAGATCATGTTTGAGA
Reverse: GCATGAGGGAGCGCGTAA
α-SMA Forward: ACCATCGGGAATGAACGCTT
Reverse: CTGTCAGCAATGCCTGGGTA
Col1a1 Forward: GACTGTCCCAACCCCCAAAA
Reverse: CTTGGGTCCCTCGACTCCTA
Fibronectin Forward: GGATCCCCTCCCAGAGAAGT
Reverse: GGGTGTGGAAGGGTAACCAG
Col8a Forward: AGAGTACCCACACCTACCCC
Reverse: TTTTGGGCACCACTTCCTTG
N-cadherin Forward: CCATCACCCGGCTTAATGGT
Reverse: CGATCCTGTCTACGTCGGTG
CTGF Forward: GCGCCTGTTCTAAGACCTGT
Reverse: GGCTTGGCAATTTTAGGCGT

Statistical analysis

When all pathological sections are analyzed, analysts are blind to the specific grouping of images, so as to eliminate bias. The experimental data were statistically analyzed by using GraphPad Prism 9.0 software, and the quantitative data were expressed as the mean ± standard error of mean (SEM). For the data comparison between the two groups with normal distribution and homogeneous variance, unpaired two-tailed Student’s t-test statistics are used; Mann-Whitney U test was used to compare the data between the two groups that did not conform to the normal distribution. Unpaid t-test with Welch’s correction was used to compare the data between the two groups, which are in accordance with normal distribution but have uneven variance. The pathological data of development time points were analyzed by Two-way analysis of variance and compared by Fisher’s least significant difference (LSD) test. P<0.05 is considered to be statistically different.


Results

Establishment of the rat model of chronic hyperoxia-induced lung injury.

Neonatal rats were continuously exposed to chronic hyperoxia for 14 days after birth, and the alveolar development of rats was observed and evaluated by HE staining (Figure 1A). The results showed that, compared with RA rats, the RAC of HO rats decreased (8.143±0.6701 vs. 12.75±0.4532, P<0.0001) and MLI increased (79.53±2.538 vs. 48.14±1.406 µm, P<0.0001), suggesting that the alveolar number decreased, the alveolar space increased (Figure 1B,1C). Western Blot was used to detect the damage of alveolar epithelial cells (Figure 1D). The results showed that the expression levels of alveolar type I epithelial cell marker PDPN and alveolar type II epithelial cell marker SPC were significantly decreased (Figure 1E,1F). When α-SMA is expressed in pulmonary vascular muscle layer, it is often related to vascular thickness. After 14 days of chronic hyperoxia exposure, α-SMA immunohistochemical staining was used to evaluate the degree of pulmonary vascular wall myomorphism (Figure 1A). The results showed that compared with RA rats, the mean thickness index (MTI) of HO rats was significantly increased (0.4851±0.0431 vs. 0.2681±0.0334, P<0.01). and the vascular smooth muscle was thickened (Figure 1G). Western blot was used to detect the expression of pulmonary vascular endothelial cells (Figure 1D). The results showed that the expression of CD31, a marker of pulmonary vascular endothelial cells, in HO group was significantly lower than that in RA group (Figure 1H). After 14 days of chronic hyperoxia exposure, Masson staining was used to evaluate the deposition of pulmonary interstitial collagen. The results showed that the volume fraction of pulmonary collagen CVF in HO group was significantly higher than that in RA group (0.2082±0.0126 vs. 0.1464±0.0162, P<0.05), and the pulmonary interstitial collagen increased (Figure 1I). α-SMA is also a marker of lung myofibroblasts in the lung. Western Blot was used to detect the expression of lung myofibroblasts marker (Figure 1D). The results showed that compared with RA group, the relative expression level of myofibroblast marker α-SMA in HO group increased significantly (Figure 1J).

Figure 1 Chronic hyperoxia-induced lung injury in neonatal rats resulted in alveolar development stagnation, pulmonary vascular dysplasia and interstitial collagen deposition. (A) Representative images of HE staining, Masson staining and α-SMA IHC staining in lung tissue of chronic hyperoxia lung injury for 14 days; scale =200 μm. (B) Statistical analysis of RAC in RA and HO groups at P14; N=6 per group. (C) Statistical analysis of MLI in RA and HO groups at P14; N=6 per group. (D) CD31, PDPN, α-SMA, SPC in lung tissue of rats in RA and HO groups at P14. Western blot results of expression level; N=6 per group. (E) Statistical analysis of PDPN expression level; N=6 per group. (F) Statistical analysis of SPC expression level; N=6 per group. (G) Statistical analysis of pulmonary vascular MTI in RA and HO groups at P14; N=5 per group. (H) Statistical analysis of the expression level of CD31; N=6 per group. (I) Statistical analysis of CVF in RA and HO groups at P14; N=6 per group. (J) Statistical analysis of α-SMA expression level; N=6 per group. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. α-SMA, α-smooth muscle actin; CD31, cluster of differentiation 31; CVF, collagen volume fraction; HE, hematoxylin and eosin; HO, hyperoxia; IHC, immunohistochemical; MLI, mean linear intercept; MTI, mean thickness index; P, postnatal day; PDPN, podoplanin; RA, room air; RAC, radical alveolar count; SPC, surfactant protein C.

Dynamic changes in interstitial collagen deposition in a neonatal rat model of chronic hyperoxia-induced lung injury

In order to further clarify the occurrence, development and prognosis of pulmonary fibrosis in chronic hyperoxia-induced lung injury, samples were collected at the early (P3), middle (P7) and late (P14) stages of chronic hyperoxia exposure and at various stages after hyperoxia removal (P21, P28 and P42). Masson staining was used to count the deposition degree of pulmonary interstitial collagen at different time points, and western blot and qPCR were used to detect the changes of Col I protein and mRNA expression level of type I collagen. The results showed that, compared with RA group, in HO group, pulmonary interstitial blue fibers increased from P14, while in P21, local fibers proliferated until P42 (Figure 2A). CVF increased significantly from P14 to P42 (P14: P<0.05; P21: P<0.01; P28: P<0.001; P42: P<0.01) (Figure 2B), and the expression level of Col I protein increased significantly at P21 by western blot (Figure 2C,2D), while the expression of Col I alpha 1 (Col1a1) mRNA decreased significantly at P7 and P14 and increased significantly at P21 by RT-qPCR (Figure 2E). The results suggest that in the late stage of hyperoxia exposure, tissue proliferation and repair are disordered after lung injury, which leads to excessive collagen deposition in pulmonary interstitial and pulmonary fibrosis reaches its peak.

Figure 2 Change of pulmonary fibrosis in chronic hyperoxia lung injury. (A) Masson staining representative graphs of RA and HO groups at 6 time points P3, P7, P14, P21, P28 and P42; scale =200 μm; (B) line charts of CVF changes in RA group and HO group at 6 time points, N=6 per group; (C) western blot results of Col I in RA and HO groups at 6 time points; (D) statistical analysis chart of Col1a1 protein expression, N=3 per group; (E) statistical analysis chart of Col1a1 mRNA expression, N=6–8 per group. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant. CVF, collagen volume fraction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HO, hyperoxia; P, postnatal day; RA, room air.

Temporal changes in lung fibroblast activity in a neonatal rat model of chronic hyperoxia-induced lung injury

Under normal circumstances, lung fibroblasts are located at the entrance of alveolar ring, which produce secondary septa during lung development and participate in the normal development of alveoli (15). Under hyperoxia exposure, lung fibroblasts are the main cell source for synthesizing and secreting extracellular matrix (ECM). Earlier, we have made it clear that pulmonary fibrosis began to be significant in the late stage of hyperoxia exposure. The distribution of lung fibroblasts in chronic hyperoxia lung injury was further observed by α-SMA immunohistochemical staining, and the expression levels of α-SMA protein and mRNA were detected by western blot and RT-qPCR. The results showed that compared with RA group, the α-SMA positive area in HO group increased significantly from P7 to P21 (P7: P<0.001; P14: P<0.001; P21: P<0.05) (Figure 3A,3B). The expression of α-SMA protein increased at P14, and there was no significant difference at other time points (Figure 3C,3D), while the expression level of α-SMA mRNA increased at P7, and there was no significant difference at other time points (Figure 3E). Combined with the results in Figure 2, we found that the expression of α-SMA mRNA, a cell marker of fibroblasts, increased in hyperoxia P7, α-SMA protein increased in hyperoxia P14, and Col I mRNA and protein, the main components of ECM secreted by fibroblasts, increased in P21, and there was no significant difference at other time points.

Figure 3 Changes of lung fibroblasts in chronic hyperoxia-induced lung injury. (A) Immunohistochemical staining of α-SMA in RA and HO groups at six time points P3, P7, P14, P21, P28 and P42; scale =200 μm; (B) Statistical analysis chart of positive area ratio of RA and HO groups at 6 time points, N=6 per group; (C) Western blot results of α-SMA expression in RA and HO groups at 6 time points; (D) statistical analysis chart of α-SMA protein expression, N=3 per group; (E) statistical analysis chart of α-SMA mRNA expression at 6 time points, N=6–8 per group. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant. α-SMA, α-smooth muscle actin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HO, hyperoxia; mRNA, messenger ribonucleic acid; P, postnatal day; RA, room air.

Dynamic changes in interstitial collagen deposition in a neonatal rat model of chronic hyperoxia-induced lung injury

To understand and describe the characteristics of pulmonary fibrosis more comprehensively, we detect the mRNA expression levels of other pulmonary fibrosis-related molecules such as collagen VIII alpha 1 (Col8a1), fibronectin, N-cadherin, connective tissue growth factor (CTGF) by RT-qPCR. The results showed that the expression of Col8a1 mRNA was significantly increased at P21 (Figure 4A), Fibronectin mRNA (Figure 4B) and N-cadherin mRNA (Figure 4C) were increased at P3 and P21, and the expression of CTGF mRNA (Figure 4D) was increased from P7 to P21, and there was no significant difference at other time points.

Figure 4 Changes of pulmonary fibrosis related molecules in chronic hyperoxia-induced lung injury. Statistical analysis of Col8a1 (A), fibronectin (B), N-cadherin (C) and CTGF (D) mRNA expression levels in rats of RA and HO groups at P3, P7, P14, P21, P28 and P42. N=6–8 per group. *, P<0.05; **, P<0.01; ns, not significant. CTGF, connective tissue growth factor; HO, hyperoxia; mRNA, messenger ribonucleic acid; P, postnatal day; RA, room air.

Discussion

Lung development progresses through five distinct stages: the embryonic, pseudoglandular, canalicular, saccular, and alveolar stages (16). The extremely preterm infants at birth are still in canalicular or saccular stage of lung development. This developmental immaturity underlies the pathogenesis of BPD, as the immature lungs are particularly vulnerable to various postnatal insults, including hyperoxia, infection, and mechanical ventilation. Therefore, establishing an animal model for mimicking BPD is essential for studying the pathogenesis of BPD and finding potential therapeutic targets. Currently, rodent models are the most widely used for studying BPD in preterm infants, and the common modeling methods include hyperoxia exposure model, intrauterine infection model, postnatal infection model (17). The lung development of rats is in saccular stage at birth, which is equivalent to the lung development stage of preterm infants at the gestataion of 26–28 weeks (18). Therefore, neonatal rats can serve as a suitable model for investigating premature lung injury.

Our research group previously found that neonatal rats were well tolerated and had significant pathological characteristics after continuous hyperoxia exposure for 14 days (19). Based on this finding, we established a chronic hyperoxia induced lung injury model by exposing neonatal rats to hyperoxia for 14 days. At P14, rats in the HO group exhibited hallmark features of BPD, including reduced alveolar number, enlarged alveolar spaces, interstitial collagen deposition, and marked muscularization of the pulmonary vascular wall. These histopathological changes were further supported by consistent molecular expression profiles. Overall, the model successfully replicated key features of human BPD and aligned with our previous findings, demonstrating its reliability for further mechanistic and therapeutic research.

Current research on the BPD has generally focused on the pathogenesis, prevention and treatment of alveolar simplification and pulmonary hypertension (20,21), with little attention given to the role of pulmonary fibrosis. This is particularly concerning given that, once established, pulmonary fibrosis in infants suffered with BPD is often difficult to reverse.

It is worth noting that, unlike pulmonary fibrosis in adults, BPD associated pulmonary fibrosis occurs in the context of a developing lung. Immature lungs possess a unique capacity for tissue repair and regeneration; however, when exposed to injurious stimuli such as hyperoxia, this regenerative process may become dysregulated, leading to abnormal repair and fibrotic remodeling (22). This raises key questions: How does pulmonary fibrosis progress in the immature lung? Can the natural course of lung development and regeneration mitigate or reverse fibrotic changes? To address these questions, we established a neonatal rat model of BPD with 14 days of continuous hyperoxia exposure and systematically examined the progression of pulmonary fibrosis at six developmental time points, from early postnatal life (P3) to adolescence (P42), using histopathological staining. Our finding revealed that chronic hyperoxia exposure led to alveolar development stagnation, pulmonary vascular dysplasia and dynamic accumulation of collagen deposition. Notably, both the pathological features and associated molecular changes of pulmonary fibrosis demonstrated distinct stage-specific patterns. We also observed that the expression of several fibrosis related molecules in HO group increased from P21 compared with RA control group, however, their mRNA expression level did not continue increase after P21. This suggests that the mRNA expression may reach the peak around P21, after which transcription stabilizes. Despite this plateau in gene expression, the ECM already deposited by this stage appears to persist, indicating that once fibrotic remodeling is established, it may be difficult to reverse, even in the context of ongoing lung development.

Fibroblasts, as the most important interstitial cells in the lung, play a central role in maintaining and remodeling the ECM. In the early postnatal period, exposure to hyperoxia may induce transient fibroblast injury or cell death (23). However, during prolonged hyperoxic exposure, particularly under the influence of profibrotic cytokines such as transforming growth factor-beta (TGF-β), fibroblasts undergo differentiation into myofibroblasts. These myofibroblasts are characterized by increased expression of α-SMA and contribute to excessive ECM production, including fibers and collagen (24). In our study, we observed that in the HO group, the percentage of α-SMA positive areas was slightly reduced during the early postnatal stage compared with the RA control group, suggesting early fibroblast suppression or loss. However, α-SMA expression markedly increased during the middle and late stages of hyperoxia exposure, indicating enhanced myofibroblast activation, but it could not indicate that the number of fibroblasts increased. This upregulation was associated with a significant increase in ECM secretion, supporting the role of fibroblast-to-myofibroblast transition in driving pulmonary fibrosis in the BPD model.

During normal lung development, ECM provides a crucial structural scaffold that supports the growth and organization of resident lung cells, facilitating to form proper alveolar formation. In addition to its mechanical role, the ECM also regulates key signaling pathways essential for maintaining alveolar elasticity and structural integrity (25,26). However, in BPD associated pulmonary fibrosis, the composition and distribution of ECM are significantly altered. Collagen, in particular, is abnormally overexpressed and disorganized, and the balance between collagen and elastin is disrupted. Under hyperoxia conditions, normal cross-linking of ECM components is impaired, further exacerbating this imbalance (27).

Clinically, abnormal lung function can be caused by many factors, such as repeated lung inflammation, airway hyperresponsiveness, large airway abnormality and pulmonary fibrosis (28). Many studies have shown that infants with BPD continue to exhibit abnormal pulmonary function into adulthood (11,29). Common manifestations include reduced forced expiratory volume in one second (FEV1), a decreased FEV1/forced vital capacity (FVC) ratio, and increased residual lung volume (11). In addition, studies have found that almost all infants with severe BPD have abnormal pulmonary function, of which 51% are obstructive, 40% are mixed and 9% are restrictive (30). This may be due to persistent lung inflammation caused by postnatal hyperoxia, infection and other stimuli, which may not only lead to airway abnormality and airway hyperresponsiveness, but also leads to ECM deposition and remodeling in pulmonary interstitial, further promoting airway restraint and deformation. However, our study has only focused on the pathological and molecular features of pulmonary fibrosis in a neonatal rat model of BPD, functional assessments were not included. To fully understand the long-term impact of fibrosis on respiratory health, it is necessary to monitor pulmonary function in these animals over time—from early postnatal stages through adolescence. This would allow us to correlate structural and molecular changes with functional outcomes, thereby strengthening the translational relevance of the model and informing potential therapeutic strategies.

Above all, our study evaluated the temporal progression of pulmonary fibrosis in chronic hyperoxia lung injury. By analyzing both histopathological changes and molecular expression profiles, we found that pulmonary fibrosis progressively intensified and peaked during the later stages following hyperoxia exposure. This finding offers a novel temporal perspective on the development of fibrosis in BPD. Importantly, these results provide critical experimental evidence for identifying optimal windows of clinical intervention. Understanding when fibrosis becomes most pronounced may inform the timing of therapeutic strategies aimed at preventing or mitigating long-term lung damage in preterm infants with BPD. However, this study provides a primarily descriptive analysis of lung development morphology of neonatal rats in hyperoxia group and control group, A key limitation is that the core genes and signaling pathways underlying the fibrotic phenotype observed at P21 remain unexplored, which will be our subsequent research work in the future.


Conclusions

Neonatal rats had been exposed to chronic hyperoxia for 14 days since birth, and their lungs had the characteristics of alveolar development retardation, pulmonary vascular dysplasia and pulmonary fibrosis, which accords with the clinical characteristics of BPD in premature infants. In chronic hyperoxia-induced lung injury, the phenotype of pulmonary fibrosis began to appear at P14, peaked at P21, and then gradually stabilized.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-574/rc

Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-574/dss

Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-574/prf

Funding: None.

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-574/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were performed under a project license (No. 00076) granted by the Ethics Committee of Children’s Hospital of Fudan University, in compliance with National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Tréluyer L, Nuytten A, Guellec I, et al. Neurodevelopment and healthcare utilisation at age 5-6 years in bronchopulmonary dysplasia: an EPIPAGE-2 cohort study. Arch Dis Child Fetal Neonatal Ed 2023;109:26-33. [Crossref] [PubMed]
  2. Zhu Z, Yuan L, Wang J, et al. Mortality and Morbidity of Infants Born Extremely Preterm at Tertiary Medical Centers in China From 2010 to 2019. JAMA Netw Open 2021;4:e219382. [Crossref] [PubMed]
  3. Stoll BJ, Hansen NI, Bell EF, et al. Trends in Care Practices, Morbidity, and Mortality of Extremely Preterm Neonates, 1993-2012. JAMA 2015;314:1039-51. [Crossref] [PubMed]
  4. Northway WH Jr, Rosan RC, Porter DY. Pulmonary disease following respirator therapy of hyaline-membrane disease. Bronchopulmonary dysplasia. N Engl J Med 1967;276:357-68. [Crossref] [PubMed]
  5. Kinsella JP, Greenough A, Abman SH. Bronchopulmonary dysplasia. Lancet 2006;367:1421-31. [Crossref] [PubMed]
  6. Lignelli E, Palumbo F, Myti D, et al. Recent advances in our understanding of the mechanisms of lung alveolarization and bronchopulmonary dysplasia. Am J Physiol Lung Cell Mol Physiol 2019;317:L832-87. [Crossref] [PubMed]
  7. Shukla VV, Ambalavanan N. Recent Advances in Bronchopulmonary Dysplasia. Indian J Pediatr 2021;88:690-5. [Crossref] [PubMed]
  8. Wozniak PS, Makhoul L, Botros MM. Bronchopulmonary dysplasia in adults: Exploring pathogenesis and phenotype. Pediatr Pulmonol 2024;59:540-51. [Crossref] [PubMed]
  9. Hurst JR, Beckmann J, Ni Y, et al. Respiratory and Cardiovascular Outcomes in Survivors of Extremely Preterm Birth at 19 Years. Am J Respir Crit Care Med 2020;202:422-32. [Crossref] [PubMed]
  10. Galderisi A, Calabrese F, Fortarezza F, et al. Airway Histopathology of Adolescent Survivors of Bronchopulmonary Dysplasia. J Pediatr 2019;211:215-8. [Crossref] [PubMed]
  11. Moschino L, Bonadies L, Baraldi E. Lung growth and pulmonary function after prematurity and bronchopulmonary dysplasia. Pediatr Pulmonol 2021;56:3499-508. [Crossref] [PubMed]
  12. Förster K, Strobl K, Kindt A, et al. Lung MRI scoring reveals persistence of emphysema-like changes in lungs of infants born preterm at (pre)school age. ERJ Open Res 2025;11:01183-2024. [Crossref] [PubMed]
  13. Martinez FD. Early-Life Origins of Chronic Obstructive Pulmonary Disease. N Engl J Med 2016;375:871-8. [Crossref] [PubMed]
  14. McGrath-Morrow SA, Collaco JM. Bronchopulmonary dysplasia: what are its links to COPD? Ther Adv Respir Dis 2019;13:1753466619892492. [Crossref] [PubMed]
  15. El Agha E, Thannickal VJ. The lung mesenchyme in development, regeneration, and fibrosis. J Clin Invest 2023;133:e170498. [Crossref] [PubMed]
  16. Herriges M, Morrisey EE. Lung development: orchestrating the generation and regeneration of a complex organ. Development 2014;141:502-13. [Crossref] [PubMed]
  17. O'Reilly M, Thébaud B. Animal models of bronchopulmonary dysplasia. The term rat models. Am J Physiol Lung Cell Mol Physiol 2014;307:L948-58. [Crossref] [PubMed]
  18. Tschanz SA, Salm LA, Roth-Kleiner M, et al. Rat lungs show a biphasic formation of new alveoli during postnatal development. J Appl Physiol (1985) 2014;117:89-95. [Crossref] [PubMed]
  19. Ai D, Shen J, Sun J, et al. Mesenchymal Stem Cell-Derived Extracellular Vesicles Suppress Hyperoxia-Induced Transdifferentiation of Rat Alveolar Type 2 Epithelial Cells. Stem Cells Dev 2022;31:53-66. [Crossref] [PubMed]
  20. Ding KL, Smith C, Seedorf G, et al. Nintedanib preserves lung growth and prevents pulmonary hypertension in a hyperoxia-induced lung injury model. Pediatr Res 2025;97:1676-83. [Crossref] [PubMed]
  21. Cookson MW, Gonzalez T, Bye EM, et al. Intraamniotic vitamin D preserves lung development and prevents pulmonary hypertension in experimental bronchopulmonary dysplasia due to intraamniotic sFlt-1. Am J Physiol Lung Cell Mol Physiol 2025;328:L603-15. [Crossref] [PubMed]
  22. Cui X, Fu J. Reinitiating lung development: a novel approach in the management of bronchopulmonary dysplasia. Respir Res 2024;25:384. [Crossref] [PubMed]
  23. Plikus MV, Wang X, Sinha S, et al. Fibroblasts: Origins, definitions, and functions in health and disease. Cell 2021;184:3852-72. [Crossref] [PubMed]
  24. Calthorpe RJ, Poulter C, Smyth AR, et al. Complex roles of TGF-β signaling pathways in lung development and bronchopulmonary dysplasia. Am J Physiol Lung Cell Mol Physiol 2023;324:L285-96. [Crossref] [PubMed]
  25. Bland RD, Xu L, Ertsey R, et al. Dysregulation of pulmonary elastin synthesis and assembly in preterm lambs with chronic lung disease. Am J Physiol Lung Cell Mol Physiol 2007;292:L1370-84. [Crossref] [PubMed]
  26. Zhou Y, Horowitz JC, Naba A, et al. Extracellular matrix in lung development, homeostasis and disease. Matrix Biol 2018;73:77-104. [Crossref] [PubMed]
  27. Mižíková I, Ruiz-Camp J, Steenbock H, et al. Collagen and elastin cross-linking is altered during aberrant late lung development associated with hyperoxia. Am J Physiol Lung Cell Mol Physiol 2015;308:L1145-58. [Crossref] [PubMed]
  28. Zhang H, Li X, Zhang X, et al. Quantitative CT analysis of idiopathic pulmonary fibrosis and correlation with lung function study. BMC Pulm Med 2024;24:437. [Crossref] [PubMed]
  29. Yang J, Kingsford RA, Horwood J, et al. Lung Function of Adults Born at Very Low Birth Weight. Pediatrics 2020;145:e20192359. [Crossref] [PubMed]
  30. Shepherd EG, Clouse BJ, Hasenstab KA, et al. Infant Pulmonary Function Testing and Phenotypes in Severe Bronchopulmonary Dysplasia. Pediatrics 2018;141:e20173350. [Crossref] [PubMed]
Cite this article as: Wu H, Shen W, Chen C, Yuan L. The characteristics of pulmonary fibrosis in a neonatal rat model of chronic hyperoxia lung injury. Transl Pediatr 2025;14(12):3409-3419. doi: 10.21037/tp-2025-574

Download Citation