Transient receptor potential melastatin 7 aggravates necrotizing enterocolitis by promoting an inflammatory response in children
Highlight box
Key findings
• TRPM7 aggravates NEC by promoting the NLRP3-dependent inflammatory response in children.
What is known and what is new?
• TRPM7 was involved in miR-129-5p-regulated NLRP3 inflammasome activation;
• TRPM7-mediated calcium flux contributes to NLRP3 inflammasome activation.
What is the implication, and what should change now?
• TRPM7 is a novel therapeutic target for NEC in children, and inhibitor NS8593 might be a potential small molecule for NEC treatment.
Introduction
As a rare disease in children, necrotizing enterocolitis (NEC) leads to high morbidity and mortality. However, its pathophysiology remains largely unclear. Epidemiologic observations strongly suggest that a series of predisposing factors contribute to ischemic deficiency, including imbalances in the microvascular and excessive inflammatory response (1,2). These risk factors lead to hypoxia-ischemia, which triggers a series of inflammatory responses in the gut. Thus, excessive inflammation and aberrant reactive oxygen species (ROS) accumulation are key factors in the pathological process of NEC (3-6).
Transient receptor potential melastatin 7 (TRPM7) belongs to the membrane protein family, which works in inflammation (7-9). As an ion channel protein, TRPM7 is involved in Mg2+, Zn2+, and Ca2+ homeostasis (7,10,11). Recently, the function of TRPM7 in immune response has attracted much attention (12). TRPM7 channel activity is critical for macrophage proliferation and polarization, and its inhibitor NS8593 reduces pro-inflammatory cytokine tumor necrosis factor alpha (TNF-α) expression (13). Conversely, the TRPM7 channel is associated with lipopolysaccharide (LPS)-induced inflammatory responses. Interleukin-1β (IL-1β) secretion was reduced in TRPM7-deficient macrophages via TRPM7-mediated calcium ion influx (14,15). More importantly, TRPM7 has been shown to be widely expressed in the intestine; however, its function in NEC has not been well defined. NLR pyrin domain containing 3 (NLRP3) inflammasome has been shown to participate in the innate immune system (16,17). It is reported that NLRP3 inflammasome is abnormally activated in severe acute colitis (18). Recently, it was found that TRPM7 contributed to NLRP3 inflammasome activation in cardiac myoblasts injury (19). Our study explored the underlying mechanism on TRPM7 and NLRP3 in NEC, and showed that TRPM7 aggravates NEC by promoting the NLRP3-dependent inflammatory response in children, and its inhibitor NS8593 might be a potential small molecule for NEC treatment. We present the following article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tp.amegroups.com/article/view/10.21037/tp-22-633/rc).
Methods
Patients
NEC intestinal tissue specimens were collected from 15 children diagnosed with NEC at The Affiliated Hospital of Zunyi Medical University, and their adjacent normal tissue specimens were also collected as a control. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the Ethics Committee of The Affiliated Hospital of Zunyi Medical University (No. KLL-2019-016) and informed consent was taken from all the patients’ legal guardians.
Cell culture
Mouse small intestinal cells IEC-6 were purchased from the American Type Culture Collection. The cells were routinely cultured in Roswell Park Memorial Institute Medium-1640 (Meilunbio, China) supplemented with 10% fetal bovine serum (Gibco) under 37 ℃ with 5% carbon dioxide.
Quantitative real-time polymerase chain reaction
The total ribonucleic acid (RNA) was extracted from the cells using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA), and a complementary deoxyribonucleic acid synthesis was then undertaken (DRR047A, Takara, Tokyo, Japan). The relative expression of the target genes was calculated using the relative quantification (2 −ΔΔCt) method and normalized. The primers used in this study are listed in Table 1.
Table 1
| Name | Sequence (5'–3') |
|---|---|
| TNF-α | CTCAAAACTCGAGTGACAAGC |
| CCGTGATGTCTAAGTACTTGG | |
| IL-6 | CCAATTTCCAATGCTCTCCT |
| ACCACAGTGAGGAATGTCCA | |
| IL-1β | ATGATGGCTTATTACAGTGGCAA |
| GTCGGAGATTCGTAGCTGGA | |
| NLRP3 | GATCTTCGCTGCGATCAACAG |
| CGTGCATTATCTGAACCCCAC | |
| TRPM7 (human) | ACTGGAGGAGTAAACACAGGT |
| TGGAGCTATTCCGATAGTGCAA | |
| GAPDH (human) | GGAGCGAGATCCCTCCAAAAT |
| GGCTGTTGTCATACTTCTCATGG | |
| TRPM7 (rat) | AGGATGTCAGATTTGTCAGCAAC |
| CCTGGTTAAAGTGTTCACCCAA | |
| GAPDH (rat) | AGGTCGGTGTGAACGGATTTG |
| GGGGTCGTTGATGGCAACA |
TNF-α, tumor necrosis factor α; IL, interleukin; NLRP3, NLR family pyrin domain containing 3; TRPM7, transient receptor potential melastatin 7; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Western blot and enzyme-linked immunosorbent assays (ELISAs)
The total protein was extracted from the tissues or cells and quantified using a BCA kit. Next, Western blot was performed using the antibodies [TRPM7 (ab245408), NLRP3 (CST 15101)]. The content of the cytokines in the serum samples and cell supernatants were detected using the corresponding ELISA kits (R&D, USA).
ROS assays
The cells were collected after being washed twice with pre-cold phosphate buffered solution (PBS) and stained by a DCFH-DA probe (Yeasen, China) solution for half an hour at 37 ℃. Next, the stained cells were collected by centrifugation and re-suspended in 1 mL of pre-cooled PBS. A FACSCanto II flow cytometer was used for ROS detection (20).
Animal model
Neonatal Sprague-Dawley (SD) rats (one day old, male or female, weighing 7–8 g, feed manually) were used to establish the NEC model using a method described in a previous study (21). All the rat pups were housed on a 12/12-h light/dark cycle at a moderate temperature (23±2 ℃). The investigators were as gentle as possible with the rat pups. If the rat pups became stressed, they were put into the incubator to warmup rapidly. Briefly, the rat pups were fed a formula supplemented with LPS [10 µg/g body weight (BW)] (Sigma-Aldrich, St. Louis, MO, USA) and exposed to hypothermia and hypoxia as previously described. On day 1, the SD rat pups (6–8 g) were hand-fed every 4 h with 0.1 mL of cow’s milk-based rat milk substitute formula. The feeding amount was subsequently increased 0.1 mL every 24 h until it reached 0.3 mL. The rat pups were then stressed twice every day with a hypoxic-reoxygenation treatment (whereby they breathed 100% nitrogen gas for 3 min then 100% oxygen gas for 3 min immediately thereafter) followed by a cold stress (4 ℃ for 10 min) for 3 days. The rat pups were monitored every day for clinical signs of NEC, such as abdominal distension, apnea, rectal bleeding, and lethargy. BW was assessed every day. The rat pups were randomly divided into the following 3 groups (n = at least 5 per group): the healthy control group, the NEC group, and the NS8593 group. Three mg/kg NS8593 were mixed with milk and treated to NEC rats until the end of the experiment. All animals were euthanized. Experiments were performed under a project license (No. KLL-animal-2019-20) granted by the Committee on Animal Experiments of the Affiliated Hospital of Zunyi Medical University, in compliance with the Affiliated Hospital of Zunyi Medical University institutional guidelines for the care and use of animals. A protocol was prepared before the study without registration.
Statistical analysis
Data are representative of at least three independent experiments. The results are presented as the mean ± standard error of the mean. GraphPad Prism (version 8.3.0) was used to generate all the figures and conduct the statistical analysis. The analysis was performed using a one-way analysis of variance (ANOVA) or a two-way ANOVA or a t-test. A P value <0.05 was considered statistically significant.
Results
TRPM7 and NLRP3 expression levels are increased in NEC patients
To test the TRPM7 and NLRP3 expression in the NEC patients, qRT-PCR was performed. We found that the expression of both of these 2 genes was significantly increased in patients with NEC, accompanied with severity of NEC (Figure 1A). These results hinted that TRPM7 might involve in the development of NEC. We also detected the inflammatory state by measuring the concentration of interleukin-6 (IL-6), IL-1β, and TNF-α in the serum of the NEC patients. We found that all these cytokines were significantly increased in the NEC patients (Figure 1B). We then stimulated the IEC-6 cells with 50 µg/mL LPS for 4 h and found that the TRPM7 expression levels were upregulated 2-fold after LPS treatment (Figure 1C,1D). The immunostaining results demonstrated that TRPM7 was gradually transferred from the cytoplasm to the membrane (Figure 1E). The findings suggested that TRPM7 might play a functional role in NEC development.
TRPM7 inhibitor NS8593 attenuated the pro-inflammatory cytokine release
To further verify the role of TRPM7 in NEC development, we used its inhibitor NS8593 to treat the cell model and detected the level of TNF-α, IL-6, and IL-1β in the cell culture supernatant. As expected, LPS strongly upregulated the messenger RNA (mRNA) and secretion levels of these cytokines in the IEC-6 cells, which revealed the increased transcriptional activity of the pro-inflammatory cytokines (Figure 2A,2B). After adding NS8593 (20 µM), the expression levels of these cytokines decreased (Figure 2A,2B). The above results indicated that the TRPM7 inhibitor NS8593 inhibited LPS-induced cytokine production and exhibited anti-inflammatory activity. The accumulation of free oxygen and free radicals is another major feature in the process of NEC. Thus, we examined the level of ROS using dichloro-dihydro-fluorescein diacetate (DCFH-DA) assays. It was demonstrated that the ROS levels in the LPS-treated IEC-6 cells were significantly increased but decreased significantly when NS8593 was introduced (Figure 2C). In sum, NS8593 was shown to inhibit the inflammatory response and maintain redox homeostasis by targeting TRPM7.
TRPM7 activated NLRP3 inflammasome as an ion channel protein
To investigate whether TRPM7 participates in NLRP3 inflammasome activation, the IEC-6 cells were pre-treated with NS8593, and then treated with LPS for 4 h, followed by adenosine triphosphate (ATP) challenged for 30 minutes. We found that NS8593 significantly blocked the secretion of IL-1β (Figure 3A). Additionally, NS8593 inhibited ATP-induced NLRP3 expression (Figure 3B). Next, we explored the inhibiting effect of NS8593 on nigericin, which activated NLRP3 inflammasome. Similarly, NS8593 effectively blocked the release of IL-1β and decreased NLRP3 expression (Figure 3C,3D). These findings suggest that the inhibition of TRPM7 alleviates NLRP3 inflammasome activation in intestinal epithelial cells. Next, we detected cytosolic Ca2+ signaling in the IEC-6 cells after 4 h of LPS treatment. As Figure 3E shows, incubation with LPS significantly increased the intracellular Ca2+ level compared to that of the untreated cells. Additionally, fluorescence was reduced after NS8593 treatment (Figure 3F). These findings suggest that TRPM7 mediates NLRP3 inflammasome activation via Ca2+ signaling.
NS8593 alleviated NEC development in vivo
Finally, we evaluated whether TRPM7 was involved in the occurrence of NEC in vivo, and whether its inhibitor played a certain therapeutic role. At the beginning of the modeling, the BW of the NEC group and the NS8593-treated NEC group did not differ significantly. During the modeling period, the NEC group lost more BW than the NS8593-treated NEC (NEC + NS8593) group (Figure 4A). Before sacrifice, the BW of the NEC + NS8593 group was significantly higher than that of the NEC group. The final survival rates of the 3 groups differed significantly as follows: 25% for the NEC group, 50% for the NEC + NS8593 group, and 100% for the control group (Figure 4B). There were distinct NEC-like pathological changes in the intestinal tissue of the NEC group. However, these phenotypes were obviously relieved in the NEC + NS8593 group (Figure 4C). The mRNA results showed that TRPM7 and NLRP3 expression were significantly upregulated in the NEC group, the expression of pro-inflammatory cytokines was also increased (Figure 4D), while the inflammatory levels were decreased after administration NS8593 (Figure 4E). Taken together, the results suggest that TRPM7 inhibitors might be potential small molecules for the NEC treatment.
Discussion
NEC is characterized by excessive inflammatory responses and LPS-induced ROS accumulation (2,3). Our current work revealed that TRPM7, a calcium-permeable ion channel, ameliorated inflammation in NEC by reducing NLRP3 activation. In the pathogenesis of NEC, LPS-activated inflammation is well described (22). Briefly, LPS triggers inflammatory cytokine release by stimulating nicotinamide adenine dinucleotide phosphate oxidase and mitochondrial ROS production (23). Accumulated ROS play a key role in toll-like receptor 4 signaling, and the inhibition of ROS production or the direct scavenging of ROS as antioxidants has been shown to attenuate intestinal mucosa damage (24,25). Recent studies have shown that ROS is considered a downstream signal of NLRP3 activation, which controls pro-inflammatory cytokine production. Excess pro-inflammatory cytokines were detected in NEC development and were found to be correlated with the severity of inflammation (21). It has been examined that the effect of Ca2+ influx on NLRP3 inflammasome activation and cytokine release (26). However, the mechanism mediating calcium imbalance remains unclear.
The members of the transient receptor potential (TRP) family work as cellular Ca2+ channel proteins to mediate Ca2+ current (27). TRPM2 is reported to be particularly crucial for inflammasome activation in a ROS-dependent manner in macrophages and monocytes (28,29). However, the effect of TRPM7 on inflammasome activation is not yet known. To date, only 1 study has reported that miR-129-5p targets TRPM7 to attenuate the hypoxia/reoxygenation injury to cardiac myocytes, along with the inhibition of NLRP3 inflammasome activation (19). Once TRPM7 expression is rescued, the miR-129-5p-induced inhibition of NLRP3 inflammasome activation is counteracted, which indirectly suggests that TRPM7 regulates NLRP3 inflammasome activation. We found that TRPM7 and NLRP3 expression was upregulated in NEC patients and NEC models. Blocking TRPM7-mediated calcium efflux could reduce the release of cytokines and extenuate damage by inhibiting NLRP3 inflammasome activation. Our work suggests that TRPM7-mediated calcium flux might contribute to inflammasome activation.
Taken together, our findings revealed TRPM7 inhibitors attenuated LPS-induced ROS and reduced the release of pro-inflammatory cytokines. It also exhibited protective effects on the NEC model. Although NS8593 has not been used in clinical, it provides a candidate molecule for drug development. Our findings suggest that TRPM7 inhibitors represent a promising strategy for NEC effective therapeutics.
Acknowledgments
Funding: This study was supported by the Local Natural Science Foundation of Zunyi [grant No. Zunyi Kehe HZ character (2019) No. 78].
Footnote
Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tp.amegroups.com/article/view/10.21037/tp-22-633/rc
Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-22-633/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-22-633/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the Ethics Committee of The Affiliated Hospital of Zunyi Medical University (No. KLL-2019-016) and informed consent was taken from all the patients’ legal guardians. All the animal experiments were performed under a project license (No. KLL-animal-2019-20) granted by the Committee on Animal Experiments of the Affiliated Hospital of Zunyi Medical University, in compliance with the Affiliated Hospital of Zunyi Medical University institutional guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Kim W, Seo JM. Necrotizing Enterocolitis. N Engl J Med 2020;383:2461. [Crossref] [PubMed]
- Neu J, Walker WA. Necrotizing enterocolitis. N Engl J Med 2011;364:255-64. [Crossref] [PubMed]
- Neu J. The 'myth' of asphyxia and hypoxia-ischemia as primary causes of necrotizing enterocolitis. Biol Neonate 2005;87:97-8. [Crossref] [PubMed]
- Surmeli Onay O, Korkmaz A, Yigit S, et al. Hypoxic-ischemic enterocolitis: a proposal of a new terminology for early NEC or NEC-like disease in preterm infants, a single-center prospective observational study. Eur J Pediatr 2020;179:561-70. [Crossref] [PubMed]
- Zhang L, Fan J, He J, et al. Regulation of ROS-NF-κB axis by tuna backbone derived peptide ameliorates inflammation in necrotizing enterocolitis. J Cell Physiol 2019;234:14330-8. [Crossref] [PubMed]
- Zhou Q, Niño DF, Yamaguchi Y, et al. Necrotizing enterocolitis induces T lymphocyte-mediated injury in the developing mammalian brain. Sci Transl Med 2021;13:eaay6621. [Crossref] [PubMed]
- Numata T, Sato-Numata K, Okada Y. TRPM7 is involved in acid-induced necrotic cell death in a manner sensitive to progesterone in human cervical cancer cells. Physiol Rep 2019;7:e14157. [Crossref] [PubMed]
- Sander P, Mostafa H, Soboh A, et al. Vacquinol-1 inducible cell death in glioblastoma multiforme is counter regulated by TRPM7 activity induced by exogenous ATP. Oncotarget 2017;8:35124-37. [Crossref] [PubMed]
- Shi R, Fu Y, Zhao D, et al. Cell death modulation by transient receptor potential melastatin channels TRPM2 and TRPM7 and their underlying molecular mechanisms. Biochem Pharmacol 2021;190:114664. [Crossref] [PubMed]
- Paravicini TM, Chubanov V, Gudermann T. TRPM7: a unique channel involved in magnesium homeostasis. Int J Biochem Cell Biol 2012;44:1381-4. [Crossref] [PubMed]
- Zocchi M, Locatelli L, Zuccotti GV, et al. Magnesium Homeostasis in Myogenic Differentiation-A Focus on the Regulation of TRPM7, MagT1 and SLC41A1 Transporters. Int J Mol Sci 2022;23:1658. [Crossref] [PubMed]
- Nadolni W, Zierler S. The Channel-Kinase TRPM7 as Novel Regulator of Immune System Homeostasis. Cells 2018;7:109. [Crossref] [PubMed]
- Schilling T, Miralles F, Eder C. TRPM7 regulates proliferation and polarisation of macrophages. J Cell Sci 2014;127:4561-6. [Crossref] [PubMed]
- Schappe MS, Szteyn K, Stremska ME, et al. Chanzyme TRPM7 Mediates the Ca(2+) Influx Essential for Lipopolysaccharide-Induced Toll-Like Receptor 4 Endocytosis and Macrophage Activation. Immunity 2018;48:59-74.e5. [Crossref] [PubMed]
- Li J, Zheng Y, Li MX, et al. Tanshinone IIA alleviates lipopolysaccharide-induced acute lung injury by downregulating TRPM7 and pro-inflammatory factors. J Cell Mol Med 2018;22:646-54. [Crossref] [PubMed]
- Mangan MSJ, Olhava EJ, Roush WR, et al. Targeting the NLRP3 inflammasome in inflammatory diseases. Nat Rev Drug Discov 2018;17:588-606. [Crossref] [PubMed]
- Kelley N, Jeltema D, Duan Y, et al. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int J Mol Sci 2019;20:3328. [Crossref] [PubMed]
- Qu S, Fan L, Qi Y, et al. Akkermansia muciniphila Alleviates Dextran Sulfate Sodium (DSS)-Induced Acute Colitis by NLRP3 Activation. Microbiol Spectr 2021;9:e0073021. [Crossref] [PubMed]
- Liu S, Liao Q, Xu W, et al. MiR-129-5p Protects H9c2 Cardiac Myoblasts From Hypoxia/Reoxygenation Injury by Targeting TRPM7 and Inhibiting NLRP3 Inflammasome Activation. J Cardiovasc Pharmacol 2021;77:586-93. [Crossref] [PubMed]
- Lin H, Chen X, Zhang C, et al. EF24 induces ferroptosis in osteosarcoma cells through HMOX1. Biomed Pharmacother 2021;136:111202. [Crossref] [PubMed]
- Yu R, Jiang S, Tao Y, et al. Inhibition of HMGB1 improves necrotizing enterocolitis by inhibiting NLRP3 via TLR4 and NF-κB signaling pathways. J Cell Physiol 2019;234:13431-8. [Crossref] [PubMed]
- Gomart A, Vallée A, Lecarpentier Y. Necrotizing Enterocolitis: LPS/TLR4-Induced Crosstalk Between Canonical TGF-β/Wnt/β-Catenin Pathways and PPARγ. Front Pediatr 2021;9:713344. [Crossref] [PubMed]
- Ferrari D, Wesselborg S, Bauer MK, et al. Extracellular ATP activates transcription factor NF-kappaB through the P2Z purinoreceptor by selectively targeting NF-kappaB p65. J Cell Biol 1997;139:1635-43. [Crossref] [PubMed]
- Molina N, Bolin AP, Otton R. Green tea polyphenols change the profile of inflammatory cytokine release from lymphocytes of obese and lean rats and protect against oxidative damage. Int Immunopharmacol 2015;28:985-96. [Crossref] [PubMed]
- Abais JM, Xia M, Zhang Y, et al. Redox regulation of NLRP3 inflammasomes: ROS as trigger or effector? Antioxid Redox Signal 2015;22:1111-29. [Crossref] [PubMed]
- Swanson KV, Deng M, Ting JP. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 2019;19:477-89. [Crossref] [PubMed]
- Clapham DE. TRP channels as cellular sensors. Nature 2003;426:517-24. [Crossref] [PubMed]
- Wang L, Negro R, Wu H. TRPM2, linking oxidative stress and Ca(2+) permeation to NLRP3 inflammasome activation. Curr Opin Immunol 2020;62:131-5. [Crossref] [PubMed]
- Zhong Z, Zhai Y, Liang S, et al. TRPM2 links oxidative stress to NLRP3 inflammasome activation. Nat Commun 2013;4:1611. [Crossref] [PubMed]
(English Language Editor: L. Huleatt)

