Diagnostic accuracy of gasdermin D as a biomarker for necrotizing enterocolitis: a single-center diagnostic test study
Highlight box
Key findings
• The study identified significantly elevated levels of gasdermin D (GSDMD) and interleukin-1β (IL-1β) in patients with necrotizing enterocolitis (NEC), with GSDMD demonstrating a higher predictive value with an area under the curve (AUC) of 0.83 compared to IL-1β (AUC 0.77). This suggests GSDMD’s potential as a reliable biomarker for early NEC diagnosis.
What is known and what is new?
• Currently, it is known that the development of NEC is multifactorial. Excessive intestinal inflammatory responses play a significant role in the pathogenesis of NEC. Furthermore, pyroptosis has been found to be closely associated with the excessive intestinal inflammation in NEC, and GSDMD is closely linked to pyroptosis.
• This study introduces GSDMD as a novel biomarker, showing its higher predictive accuracy for NEC over IL-1β. This discovery advances our understanding of NEC’s pathogenesis and highlights GSDMD’s role in pyroptosis, a programmed cell death linked to inflammation.
What is the implication, and what should change now?
• The implications of these findings are significant for neonatal care, suggesting a shift towards incorporating GSDMD and IL-1β in diagnostic protocols for early NEC detection. This could lead to improved intervention strategies, potentially reducing NEC’s morbidity and mortality in neonates. Future research should validate these biomarkers in larger cohorts and explore their mechanistic roles in NEC pathogenesis.
Introduction
Necrotizing enterocolitis (NEC) is a serious gastrointestinal condition mainly affecting premature infants, marked by intestinal inflammation and tissue death (1). Despite progress in neonatal care, NEC continues to be a major cause of illness and death in newborns (2,3). The development of NEC is complex, involving factors such as intestinal ischemia, inflammation, and microbial imbalance (4). Early detection and intervention are vital for better outcomes, but there is a lack of reliable biomarkers for NEC. Gasdermin D (GSDMD) has emerged as a molecule of interest due to its pivotal role in the inflammatory process called pyroptosis, a form of programmed cell death associated with inflammation. GSDMD is cleaved by inflammatory caspases in response to diverse stimuli, leading to the formation of membrane pores and the release of pro-inflammatory cytokines. These biological activities suggest that GSDMD is not merely elevated during inflammation but is intricately involved in the inflammatory pathways pertinent to NEC, especially considering the disease’s association with intestinal inflammation and cellular damage.
Recent studies have emphasized the role of pyroptosis, a type of programmed cell death, in inflammatory diseases (5,6). GSDMD is a crucial mediator of pyroptosis, facilitating the release of pro-inflammatory cytokines and causing cell lysis. Elevated GSDMD levels have been found to be associated with various inflammatory conditions, indicating its potential as a biomarker for disease activity (7,8). When inflammasomes are activated due to infection or cellular stress, they cleave GSDMD, which then forms pores in the cell membrane. These pores enable the release of inflammatory cytokines, including interleukin-18 (IL-18). Along with IL-1β, IL-18 is a key cytokine involved in immune responses and inflammation, and its release is a significant event in GSDMD-mediated pyroptosis (8,9).
By understanding the mechanistic role of GSDMD in NEC and building upon the existing literature, this study seeks to fill the gap in reliable biomarkers for early NEC diagnosis, ultimately contributing to better neonatal care. In this study, we examined GSDMD expression in the blood of neonates diagnosed with NEC compared to non-NEC controls. We hypothesized that GSDMD expression would be significantly elevated in patients with NEC, indicating its involvement in the inflammatory processes underlying the disease. To evaluate this hypothesis, we obtained blood samples from 53 neonates diagnosed with NEC and 53 matched controls, and quantified GSDMD expression using quantitative polymerase chain reaction (qPCR). We present this article in accordance with the STROBE reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-24-326/rc).
Methods
Study population
This study was carried out at Yunnan First People’s Hospital’s neonatal intensive care unit (NICU). We screened 207 infants admitted between December 2023 and June 2024, who exhibited clinical symptoms indicative of NEC. These symptoms included vomiting, abdominal distention, hematochezia, fever, poor mental state, hemodynamic instability, and reduced bowel sounds.
Of these, 27 cases were excluded due to congenital gastrointestinal diseases (7 cases), discharge against medical advice (10 cases), and refusal to participate (10 cases). As a result, 180 patients were included in the study (Figure 1).
Sample size estimation
In our preliminary study results, we collected blood samples from a total of 10 NEC patients and 10 non-NEC patients to compare GSDMD expression. The results showed that the mean for the NEC group was 15.23±4.6, while for the non-NEC group, it was 8.02±2.3. Based on these results, we performed the sample size calculation and determined the sample size for each group using PASS 15.0 (the NCSS, LLC, Kaysville, UT, USA) software. The formula we used for sample size estimation is
After calculation, it suggests that approximately seven samples per group are needed. However, in our practice, we collected a larger sample size to increase the robustness of results.
Group allocation
Among the included patients, 59 were diagnosed with NEC according to the Bell Stage II criteria. The remaining 121 patients did not meet the NEC diagnostic criteria and were categorized as non-NEC.
Control group
For comparison, we used propensity score matching (PSM) based on perinatal factors such as gestational age and birth weight. This matching process led to the selection of 59 patients with NEC and 56 controls for detailed analysis.
Sample collection and analysis
Blood samples were collected from both the NEC and control groups. The expression levels of GSDMD in these samples were assessed using qPCR. Additionally, inflammatory cytokine IL-1β levels were assessed using enzyme-linked immunosorbent assay (ELISA) to compare the inflammatory status between the groups.
qPCR
Total RNA was isolated from the samples using the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The concentration and purity of the RNA were evaluated using a Nanodrop spectrophotometer (ABI 7500, Thermo Fisher Scientific). Subsequently, complementary DNA (cDNA) was synthesized from 1 µg of RNA using the High-Capacity cDNA Reverse Transcription Kit (GenStar, StarScript ii, GenStar Technologies, Beijing, China) following the manufacturer’s protocols.
The primers used for the amplification were designed using Primer3 software (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) and the sequences are as follows: GSDMD forward: GCTCCAGCACCTCAATGAAT, reverse: TTCTGTGTCTGCAGCACCTC; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward: CAGCCTCAAGATCATCAGCA (used as a housekeeping gene), reverse: ATGATGTTCTGGAGAGCCCC.
The qPCR was employed to measure the levels of messenger RNAs (mRNAs) using the comparative cycle threshold (Ct) method. GAPDH was considered as the normalization control for mRNA.
ELISA
The levels of IL-1β in the samples were quantified using a commercially available ELISA kit (Elabscience, E-EL-H18000, Elabscience Biotechnology Co., Ltd., Wuhan, China) according to the manufacturer’s instructions.
Ethical considerations
The study was conducted in accordance with the Declaration of Helsinki (as was revised in 2013). The study was approved by the Ethics Committee of the Yunnan First People’s Hospital (No. KHLL2024-KY160) and informed consent was obtained from all the patients’ parents or legal guardians.
Statistical analysis
A retrospective analysis was performed on the data from patients with NEC and matched controls. Statistical analyses included t-tests for continuous variables and Chi-squared tests for categorical variables, with a P value of less than 0.05 being considered statistically significant. Statistical processing was performed using SPSS 27, an IBM statistical software (IBM, Armonk, NY, USA), and figures were created using GraphPad Prism 10 (GraphPad Software, LLC, San Diego, CA, USA).
Results
General characteristics
After PSM, there were no significant differences in general clinical characteristics, including perinatal factors, between the NEC and non-NEC groups. Baseline characteristics, including gender, birth weight, gestational age, perinatal asphyxia, neonatal respiratory distress, neonatal sepsis, and maternal conditions (gestational diabetes mellitus, pregnancy-induced hypertension, hypothyroidism, premature rupture of membranes (PROM) >18 hours, and antenatal steroid use), were well-balanced, ensuring comparability between the two groups. This indicates that the groups were effectively matched and baseline differences were minimized (Table 1).
Table 1
| General conditions | Non-NEC (n=56) | NEC (n=59) | P value |
|---|---|---|---|
| Neonatal conditions | |||
| Gender (male) | 22 (39.3) | 30 (50.8) | 0.07 |
| Cesarean section | 34 (60.7) | 29 (49.2) | 0.52 |
| Birth weight (g) | 1,973.47±656.16 | 1,742.50±744.7 | 0.08 |
| Gestational age (weeks) | 33.68±3.12 | 33±3.41 | 0.12 |
| Perinatal asphyxia | |||
| Mild | 8 (14.3) | 11 (18.6) | – |
| Severe | 4 (7.1) | 3 (5.1) | 0.66 |
| Neonatal respiratory distress | 12 (21.4) | 10 (16.9) | 0.81 |
| Neonatal sepsis | 14 (25.0) | 9 (15.3) | 0.35 |
| Maternal conditions | |||
| Gestational diabetes mellitus | 12 (21.4) | 13 (22.0) | 0.83 |
| Pregnancy-induced hypertension | 15 (26.8) | 14 (23.7) | 0.95 |
| Hypothyroidism in pregnancy | 18 (32.1) | 13 (22.0) | 0.38 |
| PROM >18 hours | 20 (35.7) | 16 (27.1) | 0.68 |
| Antenatal steroids | 41 (73.2) | 37 (62.7) | 0.91 |
Data are presented as mean ± standard deviation or n (%). NEC, necrotizing enterocolitis; PROM, premature rupture of membranes.
Clinical signs
Fatigue was significantly more common in patients with NEC (37.3%) compared to patients without NEC (1.8%) (P<0.001). Vomiting occurred more frequently in patients with NEC (40.7%) than in patients without NEC (28.6%), although this difference was not statistically significant (P=0.08). For gastric residuals, mild cases were found only in patients without NEC (5.4%), moderate cases were more prevalent in patients with NEC (52.5%) compared to patients without NEC (33.9%), and severe cases were more frequent in patients without NEC (66.1%) than in patients with NEC (42.4%) (P<0.001). Abdominal distention was significantly more common in patients with NEC (72.9%) than in patients without NEC (25.0%) (P<0.01). Hypoactive bowel sounds were significantly more frequent in patients with NEC (59.3%) compared to patients without NEC (3.6%) (P<0.01). These findings indicate that fatigue, abdominal distention, and hypoactive bowel sounds are significantly more prevalent in patients with NEC (Table 2).
Table 2
| Clinical signs | Non-NEC (n=56) | NEC (n=59) | P value |
|---|---|---|---|
| Fatigue | 1 (1.8) | 22 (37.3) | <0.001* |
| Vomiting | 16 (28.6) | 24 (40.7) | 0.08 |
| Gastric residual | 0.01* | ||
| Mild | 3 (5.4) | 0 (0.0) | |
| Moderate | 19 (33.9) | 31 (52.5) | |
| Severe | 37 (66.1) | 25 (42.4) | |
| Abdominal distention | 14 (25.0) | 43 (72.9) | <0.001* |
| Hypoactive bowel sounds | 2 (3.6) | 35 (59.3) | <0.001* |
Data are presented as n (%). *, P values are less than 0.05, indicating a statistical difference. NEC, necrotizing enterocolitis.
Laboratory findings
White blood cell counts were slightly lower in patients with NEC (10.39×109/L) compared to patients without NEC (12.76×109/L), though this difference was not statistically significant (P=0.06). Neutrophil counts were significantly lower in patients with NEC (5.41×109/L) than in patients without NEC (7.26×109/L) (P=0.03). Red blood cell counts were also significantly lower in patients with NEC (3.90×1012/L) compared to patients without NEC (4.54×1012/L) (P<0.001). In contrast, platelet counts were higher in patients with NEC (320.29×109/L) than in patients without NEC (260.1×109/L) (P=0.02). C-reactive protein (CRP) levels were significantly elevated in patients with NEC (12.48 mg/L) compared to patients without NEC (1.91 mg/L) (P<0.001), and procalcitonin (PCT) levels were also significantly higher in patients with NEC (2.34 ng/mL) compared to patients without NEC (0.78 ng/mL) (P=0.04). These results underscore significant differences in neutrophil counts, red blood cell counts, platelet counts, CRP, and PCT levels between patients with and without NEC (Table 3).
Table 3
| Laboratory findings† | Non-NEC (n=56) | NEC (n=59) | P value |
|---|---|---|---|
| White blood cell counts (×109/L) | 12.76 [4.53, 49.97] | 10.39 [3.73, 35.34] | 0.06 |
| Neutrophil counts (×109/L) | 7.26 [0.64, 26.42] | 5.41 [1.19, 25.95] | 0.03* |
| Red blood cell counts (×1012/L) | 4.54 [3.18, 5.64] | 3.90 [2.68, 5.63] | <0.001* |
| Platelet (×109/L) | 260.1 [113, 639] | 320.29 [115, 703] | 0.02* |
| CRP (mg/L) | 1.91 [0.5, 30.27] | 12.48 [0.5, 76.34] | <0.001* |
| PCT (ng/mL) | 0.78 [0.06, 12.30] | 2.34 [0.08, 30.71] | 0.04* |
Data are represented as mean [range]. †, as the data in the table do not follow a normal distribution, the Mann-Whitney U test was used. *, P values are less than 0.05, indicating a statistical difference. NEC, necrotizing enterocolitis; CRP, C-reactive protein; PCT, procalcitonin.
GSDMD and IL-1β levels in NEC and control groups
The results revealed a significant difference in the expression levels of GSDMD and the inflammatory cytokine IL-1β between the NEC and control groups (Figure 2). The NEC group showed notably higher GSDMD expression levels, suggesting a potential link with the inflammatory processes of the disease. Additionally, IL-1β levels were also significantly elevated in the NEC group, reinforcing the involvement of inflammatory pathways in the development of NEC.
Predictive capability of GSDMD and IL-1β for NEC
Receiver operating characteristic (ROC) curve analysis was conducted to assess the predictive accuracy of GSDMD and IL-1β for NEC. Based on ROC analysis, the area under the curve (AUC) for GSDMD and IL-1β is 0.83 and 0.77, respectively. The optimal cutoff value for distinguishing NEC is 12.65 (sensitivity, 0.77; specificity, 0.22) and 15.13 (sensitivity, 0.73; specificity, 0.74), respectively (Figure 3).
Correlation between GSDMD and IL-1β in NEC patients
To better understand the role of GSDMD in necroptosis and its connection to inflammatory processes, we examined the correlation between GSDMD expression levels and the concentration of the pyroptosis-related inflammatory cytokine IL-1β in the blood of patients with NEC (Figure 4). The linear regression analysis yielded a significant relationship between GSDMD and IL-1β. The best fit line is represented by the equation y = 0.9454 × x + 0.000. The slope of the regression line is 0.9454, with a standard error of 0.03206, and a 95% confidence interval ranging from 0.8819 to 1.009. This suggests that the slope is statistically significantly different from zero (F=869.6, P<0.001), confirming a strong positive correlation between GSDMD and IL-1β. In conclusion, the linear regression results demonstrate a strong and statistically significant linear relationship between the variables, supporting the hypothesis that changes in GSDMD expression are associated with changes in IL-1β level.
Discussion
NEC continues to be a major issue in neonatology, especially affecting preterm infants and resulting in high rates of morbidity and mortality. Research has indicated that NEC can also affect the white matter microstructure of the brains of preterm infants, leading to adverse long-term neurological outcomes (10). This study’s findings reveal notable differences in clinical signs, laboratory results, and biomarker levels between patients with and without NEC, providing valuable insights into potential early diagnostic tools.
Although researchers have already conducted studies on clinical prediction models for NEC (11), our study still holds promise in contributing new biomarkers for the early diagnosis of NEC, paving the way for more accurate predictive models in the future.
Our data revealed that fatigue, abdominal distention, and hypoactive bowel sounds were significantly more common in patients with NEC. These findings align with existing research, such as studies by Bazacliu and Neu [2019] and Martín et al. [2013], which also identified these symptoms as early clinical indicators of NEC (2,12). The high prevalence of abdominal distention and hypoactive bowel sounds in patients with NEC is consistent with the pathophysiological understanding of the condition, where bowel ischemia and inflammation result in impaired gastrointestinal motility and gas accumulation (13). This supports the idea that early recognition of these clinical signs could enable prompt intervention and potentially improve outcomes.
Laboratory findings further distinguished between patients with and without NEC. Patients with NEC had significantly lower neutrophil and red blood cell counts, higher platelet counts, and increased levels of CRP and PCT. These results are consistent with previous research. For instance, studies by Qin et al. [2022] reported that reduced neutrophil counts and elevated CRP and PCT levels are typical in NEC, indicating extensive inflammation and immune response exhaustion (14). The elevated platelet counts observed in our study may reflect an inflammatory response, as noted by Meng et al. [2024], emphasizing the role of systemic inflammation in NEC pathogenesis (15).
Inflammatory responses can lead to the disruption of intestinal epithelial integrity, increased permeability, and microbial translocation, which in turn contribute to the further occurrence and progression of NEC (16).
However, traditional laboratory markers such as white blood cell counts, CRP, PCT, and neutrophil counts have limitations in the early diagnosis of NEC. These markers can be affected by various factors and may lack specificity for NEC, potentially causing delays in diagnosis and treatment. This highlights the need for more specific biomarkers that can reliably indicate the onset of NEC, as emphasized by Su et al. [2022] (4). Our study adds to this growing body of evidence by identifying GSDMD and IL-1β as potential biomarkers for NEC.
The significantly higher levels of GSDMD and IL-1β in patients with NEC compared to controls suggest that these markers play a role in the inflammatory processes associated with NEC. Known for its involvement in pyroptosis, GSDMD is a type of programmed cell death linked to inflammation and may be crucial in the development of NEC. The strong correlation between GSDMD and IL-1β levels further highlights their interconnected roles in NEC’s inflammatory pathways. This finding is supported by Liu et al. [2023] and Gao et al. [2021], who demonstrated that GSDMD-mediated pyroptosis and the subsequent release of IL-1β are essential in driving inflammatory responses in various diseases (8,9).
ROC curve analysis showed that GSDMD had a higher AUC compared to IL-1β, indicating that GSDMD may be a more reliable biomarker for NEC. This is significant as it suggests GSDMD’s potential as a diagnostic tool with greater specificity and sensitivity for early NEC detection. Previous studies, such as those by Rodríguez-Antonio et al. [2021] and Yu et al. [2021], have also highlighted GSDMD’s diagnostic potential in other inflammatory conditions, supporting the relevance of our findings (5,7).
The study’s strengths include its prospective design and the application of PSM to reduce confounding factors. However, limitations such as the single-center design and relatively small sample size should be recognized. Future research should focus on validating these findings in larger, multi-center cohorts and investigating the mechanistic roles of GSDMD and IL-1β in NEC.
When comparing our findings with existing literature, it is clear that while traditional markers offer useful information, they lack the specificity required for early diagnosis of NEC. Research by Diez et al. [2020] has also highlighted the limitations of conventional markers and the necessity for new biomarkers (17). Our identification of GSDMD as a promising candidate supports these conclusions and suggests a new avenue for research and clinical practice.
Furthermore, the involvement of IL-1β in NEC is well-established, as evidenced by studies by Wang et al. [2023] and Chao et al. [2024], which highlight its role in inflammatory pathways (6,18). Our findings build on this understanding by revealing the interaction between GSDMD and IL-1β, offering a more detailed perspective on NEC pathogenesis. This relationship implies that therapeutic strategies targeting GSDMD might also influence IL-1β levels, potentially reducing inflammation and enhancing patient outcomes.
In conclusion, this study provides strong evidence that GSDMD and IL-1β are significantly elevated in patients with NEC, highlighting their potential as early biomarkers for NEC diagnosis. These findings could facilitate improved early detection and intervention strategies, ultimately enhancing outcomes for neonates at risk of NEC. Future research should aim to validate these biomarkers in larger cohorts and investigate their mechanistic roles, which could lead to the development of targeted therapies and diagnostic tools, transforming the management of NEC in neonatal care.
Conclusions
GSDMD and IL-1β can serve as valuable biomarkers for the early diagnosis of NEC, providing insights into the disease’s pathogenesis and facilitating improved strategies for early detection and intervention.
Acknowledgments
We would like to express our sincere gratitude to all the families and infants who participated in this study, making this research possible. We extend our thanks to the medical ethics committee of our hospital for their thorough review and approval of this study, ensuring that our research adhered to the highest ethical standards.
Funding: This study was supported by
Footnote
Reporting Checklist: The authors have completed the STROBE reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-24-326/rc
Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-24-326/dss
Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-24-326/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-24-326/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as was revised in 2013). The study was approved by the Ethics Committee of the Yunnan First People’s Hospital (No. KHLL2024-KY160) and informed consent was obtained from all the patients’ parents or legal guardians.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Roberts AG, Younge N, Greenberg RG. Neonatal Necrotizing Enterocolitis: An Update on Pathophysiology, Treatment, and Prevention. Paediatr Drugs 2024;26:259-75. [Crossref] [PubMed]
- Bazacliu C, Neu J. Pathophysiology of Necrotizing Enterocolitis: An Update. Curr Pediatr Rev 2019;15:68-87. [Crossref] [PubMed]
- Neu J. Necrotizing enterocolitis: an editorial. Pediatr Med 2024;7:1. [Crossref]
- Su Y, Xu RH, Guo LY, et al. Risk factors for necrotizing enterocolitis in neonates: A meta-analysis. Front Pediatr 2022;10:1079894. [Crossref] [PubMed]
- Yu P, Zhang X, Liu N, et al. Pyroptosis: mechanisms and diseases. Signal Transduct Target Ther 2021;6:128. [Crossref] [PubMed]
- Chao L, Zhang W, Feng Y, et al. Pyroptosis: a new insight into intestinal inflammation and cancer. Front Immunol 2024;15:1364911. [Crossref] [PubMed]
- Rodríguez-Antonio I, López-Sánchez GN, Uribe M, et al. Role of the inflammasome, gasdermin D, and pyroptosis in non-alcoholic fatty liver disease. J Gastroenterol Hepatol 2021;36:2720-7. [Crossref] [PubMed]
- Liu Z, Chen Y, Mei Y, et al. Gasdermin D-Mediated Pyroptosis in Diabetic Cardiomyopathy: Molecular Mechanisms and Pharmacological Implications. Molecules 2023;28:7813. [Crossref] [PubMed]
- Gao H, Cao M, Yao Y, et al. Dysregulated Microbiota-Driven Gasdermin D Activation Promotes Colitis Development by Mediating IL-18 Release. Front Immunol 2021;12:750841. [Crossref] [PubMed]
- Zhang C, Zhao X, Zhu Z, et al. Evaluation of white matter microstructural alterations in premature infants with necrotizing enterocolitis. Quant Imaging Med Surg 2023;13:6412-23. [Crossref] [PubMed]
- Dong Z, Yin X, Xu D, et al. Advancing necrotizing enterocolitis prediction through iterative monitoring. Transl Pediatr 2024;13:770-83. [Crossref] [PubMed]
- Martín FG, Sáenz de Pipaón M, Pérez Rodríguez J, et al. Risk factors for the development of necrotizing enterocolitis: a case-control study. J Neonatal Perinatal Med 2013;6:311-8. [Crossref] [PubMed]
- Abebe M, Ayehu M, Tebeje TM, et al. Risk factors of necrotizing enterocolitis among neonates admitted to the neonatal intensive care unit at the selected public hospitals in southern Ethiopia, 2023. Front Pediatr 2024;12:1326765. [Crossref] [PubMed]
- Qin F, Yuan M, Zhang C, et al. Association of neutropenia at disease onset with severe surgical necrotizing enterocolitis and higher mortality: A retrospective study. Front Surg 2022;9:971898. [Crossref] [PubMed]
- Meng W, Wang Q, Xu Q, et al. Biomarkers in the Severity of Necrotizing Enterocolitis in Preterm Infants: A Pilot Study. Int J Gen Med 2024;17:1017-23. [Crossref] [PubMed]
- Snyder KB, Hunter CJ. The leaky gut: a narrative review on the role of epithelial cell permeability in necrotizing enterocolitis. Pediatr Med 2024;7:20. [Crossref]
- Diez S, Tielesch L, Weiss C, et al. Clinical Characteristics of Necrotizing Enterocolitis in Preterm Patients With and Without Persistent Ductus Arteriosus and in Patients With Congenital Heart Disease. Front Pediatr 2020;8:257. [Crossref] [PubMed]
- Wang Q, Jin K, Su X, et al. Predictive value of serum markers in the operation evaluation of neonatal necrotizing enterocolitis. Transl Pediatr 2023;12:897-906. [Crossref] [PubMed]


