Chenodeoxycholic acid activates the TGR5/TRPA1-5-HT pathway to regulate intestinal motility in breastfed infants and mouse models
Original Article

Chenodeoxycholic acid activates the TGR5/TRPA1-5-HT pathway to regulate intestinal motility in breastfed infants and mouse models

Zihong Shan1,2, Chenghui He1,2, Qingyao Yang1,2, Jingjing Xiong1,2, Meng Li1,2, Mingyao Meng3, Yongkun Huang1,2

1Department of Pediatrics, The First Affiliated Hospital of Kunming Medical University, Kunming, China; 2Yunnan Provincial Key Laboratory of Laboratory Medicine, Kunming, China; 3Central Laboratory, Yan’an Hospital Affiliated to Kunming Medical University, Kunming, China

Contributions: (I) Conception and design: Y Huang, Z Shan; (II) Administrative support: Y Huang, M Meng; (III) Provision of study materials or patients: Y Huang, M Meng; (IV) Collection and assembly of data: Z Shan, C He, Q Yang; (V) Data analysis and interpretation: Z Shan, M Li, J Xiong; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Yongkun Huang, MD. Department of Pediatrics, The First Affiliated Hospital of Kunming Medical University, 295 Xichang Rd., Kunming 650000, China; Yunnan Provincial Key Laboratory of Laboratory Medicine, Kunming, China. Email: hykkmyncnwd@163.com.

Background: Previous research has indicated that chenodeoxycholic acid (CDCA) plays a significant role in intestinal motility and is implicated in some gastrointestinal (GI) disorders. However, the impact of CDCA on defecation patterns in infants, particularly those who are breastfed, remains unclear. This study explored the relationship between CDCA and defecation frequency in breastfed infants, focusing on the underlying mechanisms.

Methods: We measured CDCA levels in stool samples of infants with varying defecation frequencies using metabolomics, along with studies to explore the impact of CDCA on murine colonic transit and with in vitro cellular studies to elucidate the underlying physiological mechanisms.

Results: In our murine model, CDCA treatment increased GI transit distance, enhanced fecal water content, and reduced transit time, without causing significant colonic damage. Additionally, CDCA treatment enhanced 5-hydroxytryptamine (5-HT) secretion and upregulated signaling molecules such as tryptophan hydroxylase 1 (Tph1), G protein-coupled bile acid receptor 1 (TGR5), and transient receptor potential ankyrin 1 (TRPA1). Selective inhibition of these pathways suppressed 5-HT secretion and normalized intestinal motility parameters, confirming their mechanistic role. Moreover, CDCA treatment of rat insulinoma-derived RIN-14B cells also resulted in increased 5-HT secretion.

Conclusions: These findings reveal that CDCA significantly correlates with defecation frequency in breastfed infants and likely influences intestinal motility through the TGR5/TRPA1-5-HT signaling axis.

Keywords: Chenodeoxycholic acid (CDCA); intestinal motility; breastfeeding; frequency of defecation


Submitted Feb 19, 2025. Accepted for publication May 12, 2025. Published online Jun 24, 2025.

doi: 10.21037/tp-2025-100


Highlight box

Key findings

• Chenodeoxycholic acid (CDCA) levels are significantly higher in breastfed infants with increased defecation frequency compared to those with normal or decreased frequency.

• CDCA enhances intestinal motility in mice by increasing 5-hydroxytryptamine (5-HT) secretion via the TGR5/TRPA1 signaling pathway.

• Inhibiting 5-HT synthesis or blocking 5-HT receptors reverses CDCA-induced enhancement of intestinal motility.

What is known and what is new?

• Bile acids (BAs), including CDCA, influence intestinal motility in adults with gastrointestinal (GI) disorders like irritable bowel syndrome. 5-HT plays a crucial role in regulating gut motility through multiple receptor subtypes.

• This study establishes a novel correlation between fecal CDCA levels and defecation patterns specifically in breastfed infants. We identify the TGR5/TRPA1-5-HT signaling pathway as the molecular mechanism through which CDCA regulates intestinal motility. Our findings reveal that CDCA acts directly on enterochromaffin cells to stimulate 5-HT secretion.

What is the implication, and what should change now?

• These findings provide a scientific basis for understanding the wide variability in defecation patterns among exclusively breastfed infants, helping clinicians better distinguish normal variations from pathological conditions.

• The identification of the TGR5/TRPA1-5-HT pathway suggests potential therapeutic targets for managing infant GI motility disorders.

• Pediatricians should consider BA metabolism when evaluating infant stooling patterns rather than focusing solely on dietary factors.


Introduction

In pediatric outpatient and inpatient settings, concerns about infant stool patterns represent a significant source of parental anxiety and healthcare utilization (1). While variation in defecation frequency among breastfed infants is physiologically normal, ranging from several times daily to once every few days (2), understanding the biological mechanisms behind these differences has important clinical implications. Such knowledge can help clinicians better reassure anxious parents, distinguish normal variations from pathological conditions requiring intervention, and potentially identify early markers of gut development that may influence later GI health outcomes. The immature structure and function of the infant GI tract during this critical developmental window makes it particularly sensitive to various influences that shape gut physiology (3). Though breastfed infants typically produce yellow, paste-like stools compared to the thicker, pale-yellow or grayish stools of formula-fed infants (4), the factors driving the wide spectrum of defecation patterns within exclusively breastfed infants remain poorly understood. To address this knowledge gap and provide evidence-based guidance for clinical practice, we conducted a study investigating intestinal metabolites in breastfed infants with different defecation patterns.

Bile acids (BAs), derived from cholesterol metabolism, are essential gut metabolites and major components of bile. They play a key role in promoting the digestion and absorption of lipids and fat-soluble substances, protecting the liver from fat deposition, and inhibiting bacterial growth (5-7). BAs are classified into primary and secondary BAs. Primary BAs include cholic acid (CA), chenodeoxycholic acid (CDCA), glycochenodeoxycholic acid (GCDCA) and others, while secondary BAs include lithocholic acid (LCA), deoxycholic acid (DCA), ursodeoxycholic acid (UDCA) and others. CDCA has been shown to influence intestinal motility. Research by Shin et al. (8), demonstrated that patients with diarrhea-predominant irritable bowel syndrome (IBS-D) had higher fecal CDCA levels than healthy individuals, while patients with constipation-predominant irritable bowel syndrome (IBS-C) had lower fecal CDCA levels compared to healthy controls. However, the differences in CDCA levels among breastfed infants with different frequencies of defecation remain unclear.

5-hydroxytryptamine (5-HT), also known as serotonin, a major metabolite of tryptophan, plays a crucial role in maintaining GI motility (9,10). However, its role in frequency of defecation differences in breastfed infants is yet to be elucidated. In this study, we employed a translational approach beginning with metabolomic analysis of stool samples from breastfed infants categorized by defecation frequency, followed by mechanistic investigations using CDCA administration in a murine model to evaluate intestinal motility parameters, and concluding with in vitro studies using rat insulinoma-derived RIN-14B cells as an enterochromaffin cell model to elucidate the cellular pathways through which CDCA influences 5-HT secretion and subsequent intestinal motility. We present this article in accordance with the ARRIVE reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-100/rc).


Methods

Participant recruitment

From May 2022 to September 2023, 102 pairs of healthy term breastfed infants and their mothers, who attended the pediatric outpatient and preventive health care departments for health consultations and routine physical exams at The First Affiliated Hospital of Kunming Medical University, were selected for this study. Infants were grouped based on frequency of defecation as follows:

Inclusion criteria for infants: (I) full-term, singleton infants; (II) birth weight between 2.5 and 4.0 kg; (III) no congenital diseases; (IV) age between 0.5 to 6 months; (V) no use of probiotics or antibiotics within 4 weeks prior to enrollment. Exclusion criteria for infants: (I) family history of GI hereditary diseases or history of constipation; (II) infants with infectious diarrhea, metabolic and endocrine disorders, biliary diseases, anorectal abnormalities, severe eczema, milk allergy, or those whose frequency of defecation was altered due to medications; (III) infants participating in other clinical trials.

Inclusion criteria for mothers: (I) healthy during pregnancy and lactation; (II) age between 20 to 45 years; (III) no use of probiotics or antibiotics within 4 weeks prior to enrollment. Exclusion criteria for mothers: (I) gestational diabetes, pregnancy-induced hypertension, or other pregnancy-related complications; (II) organic diseases such as anemia or malnutrition; (III) habits of smoking or excessive alcohol consumption.

Grouping criteria: (I) increased frequency of defecation (IF, n=34): defecation >3 times/day; (II) decreased frequency of defecation (DF, n=32): defecation ≥4 days/time or requiring assistance for defecation; (III) normal frequency of defecation (NF, n=36): defecation ≤3 times/day.

Collection and storage of fecal samples

Fresh fecal samples from infants were collected using sterile single-use cryovials, labeled with unique identifiers, and initially stored in dry ice containers. The samples were then promptly transferred to the biobank of The First Affiliated Hospital of Kunming Medical University and stored at −80 ℃. The transport time did not exceed 1 hour. Parents were instructed to maintain a 7-day defecation diary prior to sample collection, documenting each bowel movement with date, time, and stool consistency using a simplified pictorial Bristol Stool Scale adapted for infants. Research staff provided standardized training to all parents on diary completion and sample collection procedures to ensure consistent reporting across participants.

BA-targeted metabolomic analysis

Standard compounds (0.01 g each) of CA, CDCA, GCDCA, DCA, LCA, and UDCA (Shanghai Anpu Experimental Technology Co., Ltd.; listed in Table 1) were accurately weighed and dissolved in methanol (Jining Hongming Chemical Reagent Co., Ltd.) to a final volume of 10 mL, preparing stock solutions at a concentration of 1,000 PPM. The stock solutions were stored at −20 ℃ for future use. To prepare the working solutions, 1 mL of each 1,000 PPM stock solution was gradually diluted with methanol to a final concentration of 0.001 PPM, with each dilution step at a ratio of 1:10, resulting in a mixed standard solution of BAs.

Table 1

Information on materials used in this study

Materials Catalog number Manufacturers
Cholic acid standard Shanghai Anpu Experimental Technology Co., Ltd., Shanghai, China
Chenodeoxycholic acid standard Shanghai Anpu Experimental Technology Co., Ltd., Shanghai, China
Glycochenodeoxycholic acid standard Shanghai Anpu Experimental Technology Co., Ltd., Shanghai, China
Lithocholic acid standard Shanghai Anpu Experimental Technology Co., Ltd., Shanghai, China
Deoxycholic acid standard Shanghai Anpu Experimental Technology Co., Ltd., Shanghai, China
Ursodeoxycholic acid standard Shanghai Anpu Experimental Technology Co., Ltd., Shanghai, China
Methanol Jining Hongming Chemical Reagent Co., Ltd., Jining, Shandong, China
Male C57BL/6 mice Chongqing Tengxin Biotechnology Co., Ltd., Chongqing, China
Chenodeoxycholic acid C104902 Aladdin, Shanghai, China
Carmine red C305814 Aladdin, Shanghai, China
Total RNA extraction kit DP451 Tiangen, Beijing, China
cDNA kit KR103-04 Tiangen, Beijing, China
qPCR kit Q711-02 Vazyme, Nanjing, Jiangsu, China
Tph1 antibody ab52954 Abcam, Shanghai, China
5-HT3R antibody ab271031 Abcam, Shanghai, China
SERT antibody ab308443 Abcam, Shanghai, China
5-HT4R antibody DF3503 Affinity, Liyang, Jiangsu, China
TRPA1 antibody 19124-1-AP Proteintech, Shanghai, China
GPBAR1 antibody 26739-1-AP Proteintech, Shanghai, China
β-actin antibody ab179467 Abcam, Shanghai, China
5-HT ELISA kit MM-0443M1 Meimian, Yancheng, Jiangsu, China
cAMP ELISA kit MM-1184M2 Meimian, Yancheng, Jiangsu, China
LX1606 T171759 Aladdin, Shanghai, China
Alosetron A125218 Aladdin, Shanghai, China
GR113808 HY-103152 Mce, Shanghai, China
SBI-115 HY-111534 Mce, Shanghai, China
HC-030031 HY-15064 Mce, Shanghai, China
Rat insulinoma-derived RIN-14B cells YS1230C YaJi Biological, Shanghai, China
Cell counting kit-8 C0038 Beyotime, Shanghai, China

The fecal samples stored at −80 ℃ were retrieved and thawed at room temperature. To the thawed samples, 2 mL of methanol was added, and the mixture was vortexed thoroughly. The samples were then centrifuged at 4,000 rpm for 5 minutes to extract the fecal supernatant. The extracted supernatant was filtered using a 0.22 µm syringe filter and transferred into chromatography vials for analysis.

The analysis was performed using a Waters ACQUITY BEH C18 column (2.1 mm internal diameter × 100 mm length, 1.7 µm particle size). The mobile phase consisted of 0.1% formic acid in water (Phase A) and acetonitrile (Phase B), with a flow rate of 0.3 mL/min. The gradient elution conditions were as follows: (I) phase A started at 60% for 0–5 minutes, decreasing to 30% from 0 to 5 minutes; (II) from 5 to 5.1 minutes, Phase A decreased to 0%, which was maintained until 7 minutes; (III) from 7 to 7.1 minutes, Phase A returned to 60%, maintaining at 60% until 10 minutes; (IV) phase B started at 40%, increasing to 70% from 0 to 5 minutes, then from 5 to 5.1 minutes, increased to 100%, and remained at 100% until 7 minutes; (V) from 7 to 7.1 minutes, phase B returned to 40%, which was maintained until 10 minutes.

The mass spectrometer used was the Waters Xevo TQD. Quantitative analysis was performed using negative ion electrospray ionization (ESI) in multiple reaction monitoring (MRM) mode. The ion source temperature was set to 150 ℃, with a desolvation temperature of 500 ℃ and a desolvation gas flow rate of 1,000 L/h. The cone gas flow rate was 50 L/h. The precursor ions for CA, CDCA, GCDCA, DCA, LCA, and UDCA were 407.3, 391.2, 448.3, 391.2, 375.3, and 392.5 m/z, respectively. The corresponding product ions were 343.3, 391.4, 74.1, 345.4, 375.8, and 391.5 m/z. The cone voltages were 66, 64, 60, 66, 64, and 68 V, and the collision energies were 34, 24, 36, 34, 38, and 32 V, respectively.

The six BAs in the standard mixture (CA, CDCA, GCDCA, DCA, LCA, and UDCA) were qualitatively identified based on their retention times, which were 2.66, 4.12, 2.79, 4.35, 6.13, and 2.83 minutes, respectively. Under the influence of the ESI interface, the separated BAs were ionized during the solvent removal process, producing ions with different charges and mass-to-charge ratios (m/z). The mass spectrometer analyzed the ions by their m/z ratios and generated a mass spectrum based on their mass-to-charge ratios.

CDCA treatment in mice

Male C57BL/6 mice (Chongqing Tengxin Biotechnology Co., Ltd.; listed in Table 1), aged 6–8 weeks, were housed under specific pathogen-free (SPF) conditions at 24 ℃ with a 12-hour light/dark cycle, and had ad libitum access to standard chow and sterile water. After one week of acclimatization, the mice were treated with CDCA (C104902, Aladdin; listed in Table 1) at concentrations of 5, 10, 20 and 40 mg/kg via enema for 7 consecutive days (11). The Control group received PBS enema. Each group consisted of 5 mice. Fecal water content was measured, and GI motility was assessed by determining the transit of a carmine red solution at 30 and 60 minutes post-gavage. GI transit time was also evaluated.

Fecal water content

Appropriately sized pieces of filter paper were placed into EP tubes pre-punctured with holes. The total mass of the tube and filter paper was measured using an electronic analytical balance with milligram precision. Fresh stools from the mice were collected by scraping onto the filter paper, and the total mass was measured again. The difference between the two measurements was recorded as the mass of the fresh stools. The EP tubes were then placed in a drying oven at 105 ℃ for 24 hours, after which the dried stools were weighed. Fecal water content (as a percentage of mass) was calculated using the following formula: Fecal water content = (Wwet – Wdry)/Wwet × 100%.

Carmine red assay for intestinal motility

Six percent carmine red (C305814, Aladdin; listed in Table 1) solution was used to assess GI transit time and distance (12,13). At 9:00 AM, 200 µL of carmine red solution was orally administered to non-fasted mice. The time to the appearance of the first red-colored stools was recorded as the GI transit time. To evaluate intestinal motility, the length of the GI tract traversed by the red marker was measured at 30 and 60 minutes post-gavage by dissecting the mice (14,15).

Hematoxylin and eosin (HE) staining

After 7 days of CDCA treatment via enema, the mice were sacrificed, and ileum tissue were harvested. The tissue samples were fixed in 4% paraformaldehyde and subjected to HE staining. Pathological changes following CDCA treatment were evaluated by assessing villus length and the distance between the villi and the muscularis layer.

Tph1 inhibitor and 5-HTRs antagonists

LX1606 (T171759, Aladdin; listed in Table 1) was used as a Tph1 inhibitor (16), while alosetron (A125218, Aladdin; listed in Table 1) and GR113808 (HY-103152, Mce; listed in Table 1) served as 5-HT3R and 5-HT4R antagonists, respectively (17,18). The experiment was divided into five groups: Control, CDCA (20 mg/kg), Alosetron (1 mg/kg), GR113808 (1 mg/kg), and LX1606 (200 mg/kg). After 7 days of CDCA (20 mg/kg) enema, Alosetron, GR113808, and LX1606 were administered by intraperitoneal injection for 7 consecutive days. The Control group and the CDCA (20 mg/kg) group received PBS via intraperitoneal injection. Each group consisted of 5 mice. At the end of the treatment, fecal water content, intestinal motility (assessed by carmine red solution at 30 and 60 minutes post-gavage), and GI transit time were measured.

TGR5 antagonist and TRPA1 inhibitor

SBI-115 (HY-111534, Mce; listed in Table 1) and HC-030031 (HY-15064, Mce; listed in Table 1) were utilized as TGR5 antagonist and TRPA1 inhibitor, respectively (19,20). The experiment was divided into four groups: Control, CDCA (20 mg/kg), SBI-115 (15 mg/kg), and HC-030031 (150 mg/kg). After 7 days of CDCA (20 mg/kg) enema, SBI-115 and HC-030031 were administered by gavage for 7 consecutive days. The Control group and the CDCA (20 mg/kg) group received PBS gavage. Each group consisted of 5 mice. At the conclusion of the treatment, fecal water content, intestinal motility (assessed by carmine red solution at 30 and 60 minutes post-gavage), and GI transit time were measured.

Quantitative polymerase chain reaction (qPCR) analysis

Total RNA was extracted from mouse colonic tissues or rat insulinoma-derived RIN-14B cells using an RNA extraction kit (DP451, Tiangen; listed in Table 1) according to the manufacturer’s instructions. One microgram of RNA was reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR (with gDNA wiper) kit (KR103-04, Tiangen; listed in Table 1). qPCR was performed on a Bioer 9600 FQD-96A fluorescence quantitative PCR instrument, with the reaction mixture (Q711-02, Vazyme; listed in Table 1) consisting of 10 µL AceQ Universal SYBR qPCR Master Mix, 2 µL cDNA, 0.4 µL of each specific upstream and downstream primer (listed in Table 2 for sequences), and 7.2 µL RNase-free water. The relative expression levels of genes were calculated using the 2ΔΔCT method and subsequently normalized.

Table 2

PCR primer sequences used in this study

Primer Forward (5'-3') Reverse (3'-5')
mTph1 CAGGAGAATCATGTGAGCCTGTTA GTGGGTCGGGTAGAGTTTGTTTAG
m5-HT3R TTCGAGAAGAGCCCGAGGGACAGA TGCCAGATGGACCAGAGCATAACC
m5-HT4R GATACAGATGTTACAACGGGCAGGAG AGCAGAGGATGATGAGGAAGGCAC
mSERT CCGTCGTCGTGTCTTGGTTCTATG TTCCGTTGGTGTTTCAGGAGTGATACTT
mTGR5 TTTGTTTCCTTTCCCTGCTTG GTGGTGGGCGACGCTCATAG
mTRPA1 CAAATCCAAACCTCCGAAAT TAGTGGCCTTGTGCTCAGTC
mβ-actin GTGACGTTGACATCCGTAAAGA GCCGGACTCATCGTACTCC
rTph1 TGTTATGGAGACTGTCCCTTGGTT AGGCGTGGGTTGGGTAGAGTTTGT
rSERT ACTTGAAACCCAACTGGCAGAAACT AGGAAGAAGATGATGGCAAAGAACG
rTGR5 AAGCCTCATCGTCATCGCCAACCT GGCAGCAGGAGCCCATAGACTTCG
rTRPA1 AGCAAATCCAAACCTCCGAAATAG CAGGCACATCTTAATCATGTCCAAGT
rβ-actin ACTGCCGCATCCTCTTCCTC CTCCTGCTTGCTGATCCACATC

m, mouse; PCR, polymerase chain reaction; r, rat.

Enzyme-linked immunosorbent assay (ELISA) analysis

The levels of 5-HT and cAMP in mice colonic tissues or rat insulinoma-derived RIN-14B cells supernatants were measured according to the manufacturer’s instructions for the ELISA kits (MM-0443M1, MM-1184M2, Meimian; listed in Table 1). The results were subsequently normalized.

Western blot analysis

Protein concentrations were determined using a protein concentration assay kit. Colonic tissue or rat insulinoma-derived RIN-14B cells lysates (30 µg per lane) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 10–12% gels. The proteins were subsequently transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 5% non-fat dry milk at room temperature for 1 hour, followed by incubation overnight at 4 ℃ with primary antibodies, including anti-Tph1 (ab52954, Abcam; listed in Table 1), anti-5-HT3R (ab271031, Abcam; listed in Table 1), anti-5-HT4R (DF3503, Affinity; listed in Table 1), anti-SERT (ab308443, Abcam; listed in Table 1), anti-TGR5 (26739-1-AP, Proteintech; listed in Table 1), anti-TRPA1 (19124-1-AP, Proteintech; listed in Table 1), and anti-β-actin (ab179467, Abcam; listed in Table 1) antibodies. After washing, a horseradish peroxidase (HRP)-conjugated secondary antibody was added, and the membrane was incubated at room temperature for 1 hour. Following another wash, the membrane was treated with a chemiluminescent detection reagent, and the results were observed.

CCK8 cell proliferation and toxicity assay

When rat insulinoma-derived RIN-14B cells (YS1230C, YaJi Biological; listed in Table 1) reached approximately 80% confluence, they were washed with PBS, digested with 0.25% trypsin, centrifuged, and resuspended in culture medium. A 20-µL aliquot of the cell suspension was placed in a cell counting chamber for precise determination of cell concentration using a cell counter. The total number of cells required for the experiment (2,000 cells per well) was calculated, and an appropriate volume of the cell suspension was added to fresh culture medium to create a new cell suspension, which was then plated in a 96-well plate (100 µL cell suspension per well). After the cells adhered to the plate, CDCA was added at different concentrations (5, 10, 15, 20 and 25 µM). At 0, 24, 48, and 72 hours post-treatment, CCK8 reagent (C0038, Beyotime; listed in Table 1) was added, and the cells were incubated at 37 ℃ for 2 hours. The absorbance was measured at 450 nm using a microplate reader.

Statistical analysis

Statistical analyses were conducted using GraphPad Prism 8.0 and SPSS 23.0. Categorical variables were presented as percentages, and comparisons were performed using the Chi-squared (χ2) test. For normally distributed continuous variables, data are expressed as mean ± standard deviation (SD). An unpaired t-test was used for comparisons between two groups with equal variance, while Welch’s t-test was applied for comparisons between groups with unequal variance. For multiple group comparisons with equal variance, one-way analysis of variance (ANOVA) was employed. For non-normally distributed continuous variables, data were presented as median [interquartile range (IQR)]. Mann-Whitney U test was used for two-group comparisons, and Kruskal-Wallis test was used for multiple group comparisons.

Ethics

This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The clinical ethics (ethics approval No. 23 of 2020) were approved by the Ethics Committee of The First Affiliated Hospital of Kunming Medical University, confirming that informed consent was obtained from all subjects and/or their legal guardians and that all volunteers provided informed consent. Animal experiments were performed under a project license (No. 2023087) granted by the ethics board of Yan’an Hospital Affiliated to Kunming Medical University in Kunming, in compliance with relevant guidelines for the care and use of animals.


Results

Differences in fecal BAs levels among breastfed infants with different frequencies of defecation

We collected clinical data from breastfeeding mothers and their infants with different frequencies of defecation and measured fecal BAs levels in the infants. There were no significant differences among the groups in terms of maternal age, ethnicity, pre-pregnancy BMI, pre-labor BMI, sleep status, dietary restriction, psychological status, work during late-pregnancy, income, breastfeeding interval, breast emptying or infant gender, age, birth weight, or delivery mode. However, the incidence of fecal consistency was significantly higher in the group with decreased frequency of defecation compared to the group with increased frequency (Tables 3,4). Regarding BAs levels, there were no significant differences in cholic acid (CA) or GCDCA levels among the groups. However, the CDCA levels in the group with IF were significantly higher than those in the groups with normal or decreased frequency. In contrast, LCA, DCA, and UDCA levels were significantly lower in the increased frequency group compared to the decreased frequency group (Table 4, Figure 1).

Table 3

Characteristics of infants’ mothers

Characteristics IF (n=34) DF (n=32) NF (n=36) F/H/χ2 P value
Age (years) 30.00 (26.75–34.00) 31.00 (27.25–33.75) 30.50 (28.00–33.75) 0.074 0.96
Ethnicity 2.249 0.33
   Han 28 (82.4) 24 (75.0) 32 (88.9)
   Minority 6 (17.6) 8 (25.0) 4 (11.1)
Pre-pregnancy BMI (kg/m2) 20.33 (19.15–23.49) 19.70 (19.16–23.17) 21.03 (19.49–24.45) 1.856 0.40
Pre-labor BMI (kg/m2) 24.96 (23.19–27.45) 23.48 (22.27–27.14) 25.97 (23.92–27.72) 3.079 0.22
Sleep status 3.969 0.14
   <7 h 16 (47.1) 10 (31.3) 9 (25.0)
   ≥7 h 18 (52.9) 22 (68.8) 27 (75.0)
Dietary restriction 0.560 0.76
   Yes 14 (41.2) 15 (46.9) 18 (50.0)
   No 20 (58.8) 17 (53.1) 18 (50.0)
Psychological status 0.431 0.90
   Normal 32 (94.1) 29 (90.6) 33 (91.7)
   Abnormal 2 (5.9) 3 (9.4) 3 (8.3)
Work during late pregnancy 0.384 0.83
   Yes 22 (64.7) 20 (62.5) 25 (69.4)
   No 12 (35.3) 12 (37.5) 11 (30.6)
Income 2.915 0.23
   ≤0.8 w 19 (55.9) 12 (37.5) 20 (55.6)
   >0.8 w 15 (44.1) 20 (62.5) 16 (44.4)
Breastfeeding interval 2.151 0.46
   ≤4 h 34 (100.0) 30 (93.8) 34 (94.4)
   >4 h 0 (0.0) 2 (6.3) 2 (5.6)
Breast emptying (yes/no, %) 0.027 0.99
   Yes 10 (29.4) 10 (31.3) 11 (30.6)
   No 24 (70.6) 22 (68.7) 25 (69.4)

Categorical variables are expressed as n (%). For non-normally distributed data, continuous variables were presented as median (IQR). BMI, body mass index; DF, decreased frequency of defecation (defecation ≥4 days/time or requiring assistance for defecation); IF, increased frequency of defecation (defecation >3 times/day); IQR, interquartile range; NF, normal frequency of defecation (defecation ≤3 times/day).

Table 4

Characteristics of infants

Characteristics IF (n=34) DF (n=32) NF (n=36) F/H/χ2 P value
Gender (male/female, %) 21/13 (61.8/38.2) 15/17 (46.9/53.1) 24/12 (66.7/33.3) 2.922 0.23
Age (days) 66.50 (34.25–90.00) 84.50 (50.50–120.00) 62.50 (48.50–120.00) 3.248 0.20
Birth weight (g) 3,098.53±367.33 3,077.34±426.05 3,018.56±427.58 0.362 0.70
Delivery mode 4.866 0.09
   Vaginal 29 (85.3) 20 (62.5) 24 (66.7)
   Cesarean 5 (14.7) 12 (37.5) 2 (33.3)
Fecal consistency 6.958 0.03
   Yes 1 (97.1) 8 (25.0) 4 (11.1)
   No 33 (97.1) 24 (75.0) 32 (88.9)
CA (µg/g) 41.72 (30.99–84.73) 66.43 (37.29–115.15) 57.70 (39.46–98.78) 4.243 0.12
CDCA (µg/g) 153.56†,‡ (98.53–228.22) 56.45 (25.17–113.87) 77.67 (44.50–156.49) 16.206 <0.001
GCDCA (µg/g) 0.05 (0.01–0.77) 0.05 (0.01–0.12) 0.04 (0.01–0.10) 1.686 0.43
LCA (µg/g) 0.00 (0.00–0.00) 0.00 (0.00–0.03) 0.00 (0.00–0.00) 11.039 0.004
DCA (µg/g) 0.00 (0.00–0.01) 0.01 (0.00–0.05) 0.00 (0.00–0.01) 7.262 0.03
UDCA (µg/g) 0.03 (0.00–0.22) 0.14 (0.03–1.15) 0.04 (0.00–0.29) 7.752 0.02

Categorical variables are expressed as n (%). For normally distributed data, continuous variables were presented as mean ± SD; for non-normally distributed data, continuous variables were presented as median (IQR). , significant difference compared to the DF group; , significant difference compared to the NF group. CA, cholic acid; CDCA, chenodeoxycholic acid; DCA, deoxycholic acid; DF, decreased frequency of defecation (defecation ≥4 days/time or requiring assistance for defecation); GCDCA, glycochenodeoxycholic acid; IF, increased frequency of defecation (defecation >3 times/day); IQR, interquartile range; LCA, lithocholic acid; NF, normal frequency of defecation (defecation ≤3 times/day); UDCA, ursodeoxycholic acid.

Figure 1 Fecal concentrations of different bile acids as a function of stool frequency. Individual bile acids measured include CA, CDCA, GCDCA, LCA, DCA, and UDCA. Groups are categorized based on defecation frequency: increased frequency of defecation (>3 times/day, n=34); normal frequency of defecation (≤3 times/day, n=36); decreased frequency of defecation (≥4 days/time or requiring assistance, n=32). Data were presented as median (IQR). *, P<0.05; ***, P<0.001. CA, cholic acid; CDCA, chenodeoxycholic acid; DCA, deoxycholic acid; GCDCA, glycochenodeoxycholic acid; IQR, interquartile range; LCA, lithocholic acid; UDCA, ursodeoxycholic acid.

CDCA promoted intestinal motility

To investigate the potential relationship between CDCA and intestinal motility, we administered CDCA enemas to mice for 7 consecutive days. At 30 minutes after oral administration of carmine dye, we observed that the transit distance of the dye increased in a dose-dependent manner (Figure 2A). Fecal water content and colonic transit distance measured 60 minutes after carmine administration increased with higher CDCA concentrations, in addition to GI transit time which decreased (Figure 2B,2C). These results suggest that CDCA promotes intestinal motility. To determine whether CDCA causes any damage to intestinal tissue, we performed histological analysis using HE staining in ileum tissues. At concentrations ranging from 5 to 40 mg/kg, no significant swelling or disruption of the intestinal villi was observed compared to the control group, indicating that CDCA did not cause damage to intestinal tissue within this concentration range (Figure 2D).

Figure 2 Impact of increasing concentrations of CDCA enemas on intestinal motility, fecal characteristics, colonic histology, and expression of serotonin pathway components. Mice received CDCA at different concentrations (Control, 5, 10, 20, and 40 mg/kg) via enema for 7 consecutive days and were then analyzed. (A) Representative images of GI transit distance after gavage of carmine red solution for 30 minutes, showing dose-dependent increases in transit. The red arrow points to the area reached by carmine red. (B) Representative images of fecal appearance, demonstrating increased water content with higher CDCA doses. (C) Quantitative measurements of fecal water content, GI transit time, and colonic transit distance after gavage of carmine red solution for 60 minutes. (D) Representative images of HE-stained ileum tissue sections showing no significant tissue damage across treatment groups. (E) Western blot analysis of key serotonin pathway proteins in colon tissue: Tph1, 5-HT3R, 5-HT4R, SERT, TGR5, and TRPA1. (F) ELISA measurements of 5-HT and cAMP levels, and qPCR analysis of mRNA expression for Tph1, 5-HT3R, 5-HT4R, SERT, TGR5, and TRPA1 in colon tissue. Data were presented as mean ± SD or median (IQR). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. n=5/group. 5-HT, 5-hydroxytryptamine (serotonin); 5-HT3R, 5-HT receptor 3; 5-HT4R, 5-HT receptor 4; cAMP, cyclic adenosine monophosphate; CDCA, chenodeoxycholic acid; ELISA, enzyme-linked immunosorbent assay; GI, gastrointestinal; HE, hematoxylin and eosin; IQR, interquartile range; qPCR, quantitative polymerase chain reaction; SD, standard deviation; SERT, serotonin transporter; TGR5, Takeda G protein-coupled receptor 5; Tph1, tryptophan hydroxylase 1; TRPA1, transient receptor potential A1.

CDCA promoted 5-HT secretion and upregulated the expression of 5-HT-related molecules

5-HT is a key metabolite in the tryptophan metabolic pathway. Its synthesis is regulated by tryptophan hydroxylase 1 (Tph1), and it can act by binding to 5-HT receptor (5-HTR) 3 and 4 in the intestinal mucosa, promoting the synthesis and secretion of cyclic adenosine monophosphate (cAMP) (21-23). In addition, 5-HT can be reabsorbed through the serotonin transporter (SERT). Takeda G protein-coupled receptor 5 (TGR5) and transient receptor potential A1 (TRPA1) have also been reported to have close associations with 5-HT signaling (24-27). In this study, we used Western blot and qPCR to measure the expression levels of Tph1, 5-HT3R, 5-HT4R, SERT, TGR5, and TRPA1 in the colonic tissue of mice. Additionally, we used ELISA to assess 5-HT and cAMP levels. Our results showed that, except for 5-HT3R, the protein and mRNA expression levels of Tph1, 5-HT4R, SERT, TGR5, and TRPA1 were significantly upregulated following CDCA treatment (Figure 2E,2F). Moreover, the secretion levels of 5-HT and cAMP were markedly increased (Figure 2F).

Inhibition of 5-HT synthesis or blocking 5-HT receptors reversed CDCA-induced enhancement of intestinal motility

To verify whether the 5-HT signaling pathway is involved in CDCA-mediated enhancement of intestinal motility, we administered intraperitoneal injections of LX1606 (Tph1 inhibitor) (16), alosetron (5-HT3R antagonist) (17), and GR113808 (5-HT4R antagonist) (18) after completing the CDCA enema treatments. Compared to the CDCA group, GI transit distance 30 minutes after carmine administration was significantly reduced in the alosetron, GR113808, and LX1606 groups (Figure 3A). We further measured fecal water content, colonic transit distance 60 minutes after carmine administration, GI transit time, and levels of 5-HT and cAMP in colonic tissues. In the alosetron, GR113808, and LX1606 groups, fecal water content and colonic transit distance were significantly reduced, while GI transit time was significantly increased compared to the CDCA group. Additionally, cAMP levels were significantly decreased after inhibition of three separate steps in the serotonin pathway. while only 5-HT levels were decreased by LX1606 (Figure 3B,3C). These results indicate that CDCA promotes intestinal motility via the 5-HT signaling pathway.

Figure 3 Impact of serotonin pathway inhibition on CDCA-induced changes in intestinal motility as described in Figure 2. After CDCA treatment (20 mg/kg via enema for 7 days), mice received inhibitors targeting different components of the serotonin signaling pathway. (A) Representative images of GI transit distance after carmine red gavage (30 min) in mice treated with: Control (PBS), CDCA only, Alosetron (5-HT3R antagonist, 1 mg/kg, blocking serotonin receptor signaling), GR113808 (5-HT4R antagonist, 1 mg/kg, blocking a different serotonin receptor subtype), or LX1606 (Tph1 inhibitor, 200 mg/kg, blocking serotonin synthesis). The red arrow as in Figure 2A. (D) Similar transit images for mice treated with Control, CDCA only, SBI-115 (TGR5 antagonist, 15 mg/kg, blocking the bile acid receptor upstream of serotonin signaling), or HC-030031 (TRPA1 inhibitor, 150 mg/kg, blocking another upstream component in the signaling pathway). The red arrow as in Figure 2A. (B,E) Representative images of fecal appearance from corresponding treatment groups. (C,F) Quantitative measurements of fecal water content, GI transit time, colonic transit distance (60 min post-carmine), and ELISA results for 5-HT and cAMP levels in colon tissue for all treatment groups. The experimental design systematically targets different points in the TGR5/TRPA1-5-HT signaling axis as detailed in the Methods section (2.8 and 2.9). Data were presented as mean ± SD. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. n=5/group. 5-HT, 5-hydroxytryptamine (serotonin); 5-HT3R, 5-HT receptor 3; 5-HT4R, 5-HT receptor 4; cAMP, cyclic adenosine monophosphate; CDCA, chenodeoxycholic acid; ELISA, enzyme-linked immunosorbent assay; GI, gastrointestinal; PBS, phosphate-buffered saline; SD, standard deviation; Tph1, tryptophan hydroxylase 1; TRPA1, transient receptor potential A1.

Blocking TGR5 or inhibiting TRPA1 reversed CDCA-induced enhancement of intestinal motility

To explore the relationship between TGR5, TRPA1, 5-HT, and intestinal motility, we administered gavage with SBI-115 (TGR5 antagonist) and HC-030031 (TRPA1 inhibitor) (19,20) after completing the CDCA enema treatments. Compared to the CDCA group, GI transit distance 30 minutes after carmine administration was significantly reduced in the SBI-115 and HC-030031 groups (Figure 3D). We further measured fecal water content, colonic transit distance 60 minutes after carmine administration, GI transit time, and levels of 5-HT and cAMP in colonic tissues. The results showed that fecal water content and colonic transit distance were significantly reduced, while GI transit time was markedly increased in the SBI-115 and HC-030031 groups compared to the CDCA group. In addition, levels of 5-HT and cAMP were significantly decreased (Figure 3E,3F). These findings suggest that CDCA promotes intestinal motility through the TGR5/TRPA1-5-HT signaling pathway.

CDCA stimulated 5-HT secretion in rat insulinoma-derived RIN-14B cells

To investigate whether CDCA stimulates 5-HT secretion in vitro, we conducted experiments using rat insulinoma-derived RIN-14B cells, which is widely established as an enterochromaffin cell model. This cell line was specifically selected for its well-documented ability to produce and secrete serotonin in response to physiological stimuli, closely mimicking the behavior of intestinal enterochromaffin cells (26). Compared to the control group, treatment with 15 µM CDCA significantly increased 5-HT secretion. CCK8 assay results showed that CDCA treatment at concentrations of 5–25 µM for 24, 48, and 72 hours did not inhibit cell proliferation (Figure 4A). We further analyzed the expression levels of Tph1, SERT, TGR5, and TRPA1 in rat insulinoma-derived RIN-14B cells using qPCR. Following treatment with 15 µM CDCA, the mRNA expression levels of Tph1, SERT, TGR5, and TRPA1 were significantly upregulated compared to the control group (Figure 4B). These results indicate that CDCA can stimulate 5-HT secretion in vitro.

Figure 4 Induction of serotonin pathway components in rat insulinoma-derived RIN-14B cells. These cells were used as an in vitro model of enterochromaffin cells to examine direct effects of CDCA treatment. (A) ELISA measurements of 5-HT secretion in response to 15 μM CDCA treatment, alongside cell proliferation assays showing no toxicity of CDCA at concentrations of 5–25 μM over 24–72 hours. (B) qPCR analysis of mRNA expression for Tph1, SERT, TGR5, and TRPA1 in RIN-14B cells following 15 μM CDCA treatment, demonstrating significant upregulation of these serotonin pathway components. Data were presented as mean ± SD. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CDCA, chenodeoxycholic acid; ELISA, enzyme-linked immunosorbent assay; qPCR, quantitative polymerase chain reaction; SD, standard deviation; SERT, serotonin transporter; TGR5, Takeda G protein-coupled receptor 5; Tph1, tryptophan hydroxylase 1; TRPA1, transient receptor potential A1.

Discussion

Our study establishes a novel connection between CDCA levels and defecation patterns in breastfed infants, revealing a positive correlation between fecal CDCA concentration and defecation frequency. This finding extends previous clinical observations linking BA metabolism to intestinal motility disorders, such as elevated CDCA in IBS-D and reduced levels in IBS-C (8), suggesting a close relationship between CDCA and intestinal motility. By demonstrating that CDCA administration directly enhances GI motility and increases fecal water content in our mouse model, we provide compelling evidence that CDCA is not merely a consequence but a potential causative factor in altered defecation patterns. The translational significance of our work lies in identifying a potential physiological mechanism underlying the wide variability in defecation patterns observed among exclusively breastfed infants. In conditions such as inflammatory bowel disease (IBD), IBS-D, and post-cholecystectomy diarrhea (PCD), numerous studies have highlighted dysbiosis and related metabolites as critical pathogenic factors (28-31). Our research provides a novel metabolomic perspective on the underlying causes of different defecation frequencies in breastfed infants.

Our mechanistic investigations revealed that CDCA exerts its pro-motility effects primarily through stimulation of 5-HT signaling. 5-HT, a major metabolite of tryptophan, plays a crucial role in maintaining normal intestinal peristalsis (9,10), and it has been well-established that 5-HT is closely associated with GI disorders, such as IBS-D and PCD (32,33). We observed increased 5-HT secretion in the colonic tissues of CDCA-treated mice, along with elevated expression of Tph1, the rate-limiting enzyme in 5-HT synthesis, and increased downstream cAMP levels of 5-HTRs. The application of LX1606 (Tph1 inhibitor), alosetron (5-HT3R antagonist), and GR113808 (5-HT4R antagonist) attenuated the pro-motility effects of CDCA, reduced fecal water content, and lowered cAMP levels, confirming that 5-HT is a critical factor in CDCA-induced intestinal motility enhancement. Both 5-HT3R and 5-HT4R have emerged as important therapeutic targets for diarrhea (21,34), with 5-HT3R antagonists such as alosetron (17,35), ondansetron, and ramosetron demonstrating clinical efficacy in treating diarrhea (35,36). Although CDCA upregulated SERT expression, which is responsible for removing 5-HT from the extracellular space to prevent excessive accumulation (37), the overall increase in intestinal motility suggests that CDCA’s promotion of 5-HT secretion outweighed its impact on 5-HT reuptake.

Our study further elucidated that TGR5 and TRPA1 are critical mediators in the CDCA-induced enhancement of intestinal motility. As BA receptors, TGR5 and TRPA1 facilitate the synthesis and secretion of 5-HT by enterochromaffin cells in the intestinal mucosa, thereby regulating GI motility (20,27,38). We observed increased expression of both TGR5 and TRPA1 in the colonic tissues of CDCA-treated mice. The application of TGR5 antagonist SBI-115 and TRPA1 inhibitor HC-030031 reduced 5-HT and cAMP secretion, inhibited GI activity, and decreased fecal water content, confirming that the pro-motility effect of CDCA is mediated via the TGR5/TRPA1 signaling pathway. These findings align with previous reports showing that deoxycholic acid can stimulate 5-HT secretion by activating TGR5, promoting intestinal motility, whereas TGR5 knockout mice exhibit significant constipation (39). Similarly, other studies have indicated that TRPA1 agonists also promote 5-HT secretion and enhance intestinal peristalsis (40). Our in vitro experiments further demonstrated that CDCA could directly stimulate 5-HT secretion from enterochromaffin cells, consistent with previous reports (33).

From a clinical perspective, our findings have significant implications for understanding the physiological basis of variable defecation patterns in infants. The identification of CDCA as a key regulator of intestinal motility through the TGR5/TRPA1-5-HT pathway provides a scientific foundation for reassuring parents about normal variations in infant stooling patterns. This mechanistic insight bridges several historically separate research areas: BA physiology, neurotransmitter signaling, and infant nutrition. Our translational approach, beginning with human infant samples and extending to mechanistic studies in animal models, offers a comprehensive framework for future investigations into how maternal factors might influence infant gut health through BA metabolism. Potential therapeutic strategies targeting this pathway could be explored for infants with persistent motility disorders, drawing on the established clinical efficacy of serotonergic agents in adult populations (17,21,34-36).

While this study provides valuable insights into BA profiles and defecation patterns, several limitations should be acknowledged. Microbial analyses were not performed, leaving unclear whether gut microbiota composition differed among breastfed infants with varying defecation frequencies, or if microbiota drove CDCA alterations. Our cross-sectional design prevented establishing causality and tracking how defecation patterns naturally evolve during early development. The sample size limited subgroup analyses by infant age and other demographic factors. We relied on parental reporting of defecation frequency without standardized validation methods. The study lacked detailed analysis of breastmilk composition differences between mothers of infants with varying stool patterns, along with limited dietary information beyond breastfeeding status. We measured only selected BAs without assessing other potential motility mediators like gut hormones that might contribute to the observed variations. Future research should address these limitations through longitudinal designs with comprehensive microbial and metabolomic profiling. Another limitation is the use of rat insulinoma-derived RIN-14B cells, which lack the natural polarization and cellular interactions of intestinal enterochromaffin cells, potentially affecting receptor expression and secretory responses to CDCA. Future studies using intestinal organoids or 3D culture systems would provide more physiologically relevant insights into these mechanisms. Additionally, future work should also include metagenomic sequencing of stool samples to identify microbial community differences potentially influencing BA metabolism, alongside transcriptomic analyses to validate serotonin-related pathways in human samples.


Conclusions

In conclusion, this study identified a relationship between CDCA and intestinal motility in breastfed infants, and elucidated the role of the TGR5/TRPA1-5-HT axis in this process in a mouse model. The inhibition of intestinal 5-HT synthesis and secretion or the blocking of selective 5-HTRs, as well as potentially increasing the synthesis of serotonin pathway proteins, may represent promising therapeutic strategies for regulating intestinal motility in infants.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-100/rc

Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-100/dss

Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-100/prf

Funding: This study was supported by the National Natural Science Foundation of China (No. 81960102) and the Open Project of the Key Laboratory of Laboratory Medicine in Yunnan Province (No. 2017DG005-2022005).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-100/coif). All authors report that this study was supported by the National Natural Science Foundation of China (No. 81960102) and the Open Project of the Key Laboratory of Laboratory Medicine in Yunnan Province (No. 2017DG005-2022005). The authors have no other conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The clinical ethics (ethics approval No. 23 of 2020) were approved by the Ethics Committee of The First Affiliated Hospital of Kunming Medical University, confirming that informed consent was obtained from all subjects and/or their legal guardians and that all volunteers provided informed consent. Animal experiments were performed under a project license (No. 2023087) granted by the ethics board of Yan’an Hospital Affiliated to Kunming Medical University in Kunming, in compliance with relevant guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Goldfeld S, Tapley A, O'Connor E, et al. Prevalence and associated skills of Australian general practice registrars seeing children with functional bowel and bladder problems. J Paediatr Child Health 2023;59:979-86. [Crossref] [PubMed]
  2. Rao CD, Maiya PP, Babu MA. Non-diarrhoeal increased frequency of bowel movements (IFoBM-ND): enterovirus association with the symptoms in children. BMJ Open Gastroenterol 2014;1:e000011. [Crossref] [PubMed]
  3. Thiagarajah JR, Kamin DS, Acra S, et al. Advances in Evaluation of Chronic Diarrhea in Infants. Gastroenterology 2018;154:2045-2059.e6. [Crossref] [PubMed]
  4. Brink LR, Mercer KE, Piccolo BD, et al. Neonatal diet alters fecal microbiota and metabolome profiles at different ages in infants fed breast milk or formula. Am J Clin Nutr 2020;111:1190-202. [Crossref] [PubMed]
  5. Sato R. Recent advances in regulating cholesterol and bile acid metabolism. Biosci Biotechnol Biochem 2020;84:2185-92. [Crossref] [PubMed]
  6. Jia W, Wei M, Rajani C, et al. Targeting the alternative bile acid synthetic pathway for metabolic diseases. Protein Cell 2021;12:411-25. [Crossref] [PubMed]
  7. Kriaa A, Bourgin M, Potiron A, et al. Microbial impact on cholesterol and bile acid metabolism: current status and future prospects. J Lipid Res 2019;60:323-32. [Crossref] [PubMed]
  8. Shin A, Camilleri M, Vijayvargiya P, et al. Bowel functions, fecal unconjugated primary and secondary bile acids, and colonic transit in patients with irritable bowel syndrome. Clin Gastroenterol Hepatol 2013;11:1270-1275.e1. [Crossref] [PubMed]
  9. Liu N, Sun S, Wang P, et al. The Mechanism of Secretion and Metabolism of Gut-Derived 5-Hydroxytryptamine. Int J Mol Sci 2021;22:7931. [Crossref] [PubMed]
  10. Agus A, Planchais J, Sokol H. Gut Microbiota Regulation of Tryptophan Metabolism in Health and Disease. Cell Host Microbe 2018;23:716-24. [Crossref] [PubMed]
  11. Goyal N, Rana A, Bijjem KR, et al. Effect of chenodeoxycholic acid and sodium hydrogen sulfide in dinitro benzene sulfonic acid (DNBS)--Induced ulcerative colitis in rats. Pharmacol Rep 2015;67:616-23. [Crossref] [PubMed]
  12. Golubeva AV, Joyce SA, Moloney G, et al. Microbiota-related Changes in Bile Acid & Tryptophan Metabolism are Associated with Gastrointestinal Dysfunction in a Mouse Model of Autism. EBioMedicine 2017;24:166-78. [Crossref] [PubMed]
  13. Al-Saffar A, Takemi S, Saaed HK, et al. Utility of animal gastrointestinal motility and transit models in functional gastrointestinal disorders. Best Pract Res Clin Gastroenterol 2019;40-41:101633. [Crossref] [PubMed]
  14. Cao H, Liu X, An Y, et al. Dysbiosis contributes to chronic constipation development via regulation of serotonin transporter in the intestine. Sci Rep 2017;7:10322. [Crossref] [PubMed]
  15. Heredia DJ, Gershon MD, Koh SD, et al. Important role of mucosal serotonin in colonic propulsion and peristaltic reflexes: in vitro analyses in mice lacking tryptophan hydroxylase 1. J Physiol 2013;591:5939-57. [Crossref] [PubMed]
  16. Schneider MA, Heeb L, Beffinger MM, et al. Attenuation of peripheral serotonin inhibits tumor growth and enhances immune checkpoint blockade therapy in murine tumor models. Sci Transl Med 2021;13:eabc8188. [Crossref] [PubMed]
  17. Camilleri M, Northcutt AR, Kong S, et al. Efficacy and safety of alosetron in women with irritable bowel syndrome: a randomised, placebo-controlled trial. Lancet 2000;355:1035-40. [Crossref] [PubMed]
  18. Spohn SN, Bianco F, Scott RB, et al. Protective Actions of Epithelial 5-Hydroxytryptamine 4 Receptors in Normal and Inflamed Colon. Gastroenterology 2016;151:933-944.e3. [Crossref] [PubMed]
  19. Li N, Koester ST, Lachance DM, et al. Microbiome-encoded bile acid metabolism modulates colonic transit times. iScience 2021;24:102508. [Crossref] [PubMed]
  20. Lieu T, Jayaweera G, Zhao P, et al. The bile acid receptor TGR5 activates the TRPA1 channel to induce itch in mice. Gastroenterology 2014;147:1417-28. [Crossref] [PubMed]
  21. Mawe GM, Hoffman JM. Serotonin signalling in the gut--functions, dysfunctions and therapeutic targets. Nat Rev Gastroenterol Hepatol 2013;10:473-86. [Crossref] [PubMed]
  22. Gershon MD, Tack J. The serotonin signaling system: from basic understanding to drug development for functional GI disorders. Gastroenterology 2007;132:397-414. [Crossref] [PubMed]
  23. Bhattarai Y, Williams BB, Battaglioli EJ, et al. Gut Microbiota-Produced Tryptamine Activates an Epithelial G-Protein-Coupled Receptor to Increase Colonic Secretion. Cell Host Microbe 2018;23:775-785.e5. [Crossref] [PubMed]
  24. de Aguiar Vallim TQ, Tarling EJ, Edwards PA. Pleiotropic roles of bile acids in metabolism. Cell Metab 2013;17:657-69. [Crossref] [PubMed]
  25. Zheng X, Chen T, Jiang R, et al. Hyocholic acid species improve glucose homeostasis through a distinct TGR5 and FXR signaling mechanism. Cell Metab 2021;33:791-803.e7. [Crossref] [PubMed]
  26. Nozawa K, Kawabata-Shoda E, Doihara H, et al. TRPA1 regulates gastrointestinal motility through serotonin release from enterochromaffin cells. Proc Natl Acad Sci U S A 2009;106:3408-13. [Crossref] [PubMed]
  27. Bellono NW, Bayrer JR, Leitch DB, et al. Enterochromaffin Cells Are Gut Chemosensors that Couple to Sensory Neural Pathways. Cell 2017;170:185-198.e16. [Crossref] [PubMed]
  28. Mars RAT, Yang Y, Ward T, et al. Longitudinal Multi-omics Reveals Subset-Specific Mechanisms Underlying Irritable Bowel Syndrome. Cell 2020;182:1460-1473.e17. [Crossref] [PubMed]
  29. Sommer F, Bäckhed F. The gut microbiota--masters of host development and physiology. Nat Rev Microbiol 2013;11:227-38. [Crossref] [PubMed]
  30. Xu Y, Jing H, Wang J, et al. Disordered Gut Microbiota Correlates With Altered Fecal Bile Acid Metabolism and Post-cholecystectomy Diarrhea. Front Microbiol 2022;13:800604. [Crossref] [PubMed]
  31. Li YD, Liu BN, Zhao SH, et al. Changes in gut microbiota composition and diversity associated with post-cholecystectomy diarrhea. World J Gastroenterol 2021;27:391-403. [Crossref] [PubMed]
  32. Vich Vila A, Imhann F, Collij V, et al. Gut microbiota composition and functional changes in inflammatory bowel disease and irritable bowel syndrome. Sci Transl Med 2018;10:eaap8914. [Crossref] [PubMed]
  33. Xu Y, Wang J, Wu X, et al. Gut microbiota alteration after cholecystectomy contributes to post-cholecystectomy diarrhea via bile acids stimulating colonic serotonin. Gut Microbes 2023;15:2168101. [Crossref] [PubMed]
  34. Ford AC, Brandt LJ, Young C, et al. Efficacy of 5-HT3 antagonists and 5-HT4 agonists in irritable bowel syndrome: systematic review and meta-analysis. Am J Gastroenterol 2009;104:1831-43; quiz 1844. [Crossref] [PubMed]
  35. Fukudo S, Kinoshita Y, Okumura T, et al. Ramosetron Reduces Symptoms of Irritable Bowel Syndrome With Diarrhea and Improves Quality of Life in Women. Gastroenterology 2016;150:358-66.e8. [Crossref] [PubMed]
  36. Garsed K, Chernova J, Hastings M, et al. A randomised trial of ondansetron for the treatment of irritable bowel syndrome with diarrhoea. Gut 2014;63:1617-25. [Crossref] [PubMed]
  37. Gao J, Xiong T, Grabauskas G, et al. Mucosal Serotonin Reuptake Transporter Expression in Irritable Bowel Syndrome Is Modulated by Gut Microbiota Via Mast Cell-Prostaglandin E2. Gastroenterology 2022;162:1962-1974.e6. [Crossref] [PubMed]
  38. Chen Z, Luo J, Li J, et al. Interleukin-33 Promotes Serotonin Release from Enterochromaffin Cells for Intestinal Homeostasis. Immunity 2021;54:151-163.e6. [Crossref] [PubMed]
  39. Alemi F, Poole DP, Chiu J, et al. The receptor TGR5 mediates the prokinetic actions of intestinal bile acids and is required for normal defecation in mice. Gastroenterology 2013;144:145-54. [Crossref] [PubMed]
  40. Yang Y, Wang S, Kobayashi K, et al. TRPA1-expressing lamina propria mesenchymal cells regulate colonic motility. JCI Insight 2019;4:e122402. [Crossref] [PubMed]
Cite this article as: Shan Z, He C, Yang Q, Xiong J, Li M, Meng M, Huang Y. Chenodeoxycholic acid activates the TGR5/TRPA1-5-HT pathway to regulate intestinal motility in breastfed infants and mouse models. Transl Pediatr 2025;14(6):1213-1229. doi: 10.21037/tp-2025-100

Download Citation