Pathogenicity effects of a COL2A1 missense mutation (c.1594G>C) in cartilage development

Introduction

The COL2A1 gene, located at the 12q13.11 region, encodes the collagen type II α1 chain, a critical component of type II collagen (1,2). Type II collagen, composed of three identical type II α1 chains forming a triple-helical structure, provides tensile strength and structural stability to cartilaginous tissues. This unique composition plays a pivotal role in cartilage development and the maintenance of joint integrity and function (3).

The COL2A1 gene is predominantly expressed in tissues such as the cartilage, vitreous humor, inner ear, and intervertebral discs (4). Mutations in this gene disrupt collagen synthesis or structure, leading to a diverse group of disorders collectively termed type II collagenopathies (4). To date, more than 20 distinct diseases have been associated with COL2A1 mutations, ranging from severe, lethal conditions such as achondrogenesis type II (ACG2) and hypochondrogenesis to less severe but debilitating disorders like Stickler syndrome, spondyloepiphyseal dysplasia congenita (SEDC), and Kniest dysplasia (4,5). These conditions manifest with varying clinical features, including short stature, joint abnormalities, spinal deformities, and craniofacial dysmorphisms, often accompanied by ocular and auditory impairments (4). Despite advances in genetic research, the underlying pathogenesis of these diseases remains incompletely understood.

ACG2 is one of the most severe phenotypes within type II collagenopathies (4-6). This rare, perinatal lethal skeletal disorder typically results in death before or shortly after birth due to the critical disruptions in type II collagen. It is characterized by profound skeletal abnormalities, including severe micromelia, a hypoplastic thoracic cavity, and inadequate ossification of the spine and pelvis (4-6). These anomalies result in life-threatening complications, particularly respiratory insufficiency, which is the primary cause of lethality.

In this study, whole-exome sequencing (WES) identified a heterozygous missense mutation in the COL2A1 gene (NM_001844.5: c.1584G>C, p.Glu532Gln) in a newborn with clinical features consistent with ACG2. To elucidate the molecular consequences of this mutation, we employed AlphaFold2 to predict its structural effects and conducted protein expression analyses using Western blot and the enzyme-linked immunosorbent assay (ELISA). Our findings aim to advance the understanding of the pathogenic mechanisms underlying COL2A1 mutations and contribute to the broader knowledge of type II collagenopathies. We present this article in accordance with the MDAR reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-79/rc).

Methods

Clinical assessment

This study was supported by the Ethics Committee of the Children’s Hospital, Zhejiang University School of Medicine (No. 2022-IRBAL-98). This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. Written informed consent was obtained from the patient’s legal guardians.

The diagnosis of ACG2 was based on comprehensive clinical, radiological, and genetic evaluations. This included detailed physical examination findings, prenatal and postnatal imaging studies, and WES, which identified a pathogenic variant in the COL2A1 gene. Advanced computational modeling and functional analyses further substantiated the deleterious impact of this variant, supporting its role in the pathogenesis of ACG2.

DNA extraction

Peripheral blood samples were obtained from individuals in the recruited family. Genomic DNA was isolated with the QIAamp^® DNA Blood Mini Kit (Qiagen, Germany), following the manufacturer’s recommended procedure. The quality and concentration of the extracted DNA were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). The extracted DNA was directly used for WES and Sanger sequencing to identify potential pathogenic variants.

WES

To perform WES on the proband, 1–3 µg of high-quality genomic DNA was used for library construction according to the protocol provided by the manufacturer (Agilent Technologies, Inc., Santa Clara, CA, USA). DNA was randomly fragmented to an average length of 150–220 bp using a Covaris^® S220 ultrasonicator (Thermo Fisher Scientific, MA, USA). Subsequent steps included end-repair, phosphorylation, addition of A-overhangs, and ligation of paired-end adaptors with unique indexes at the 3' ends. The libraries were evaluated for quality using a Qubit 3.0 Fluorometer (Life Technologies) and an Agilent 2200 TapeStation system (Agilent Technologies, Inc., Santa Clara, CA, USA). Sequencing was carried out on the Illumina HiSeq X Ten platform (Illumina, San Diego, CA, USA) using a high-throughput paired-end 150 bp paired-end reads.

The raw sequencing reads were first assessed for quality using FastQC. Clean reads were then aligned to the human reference genome (GRCh37/hg19) using the Burrows-Wheeler Aligner (BWA, version 0.7.15-r1140) with default parameters. Variant calling, base quality score recalibration, and filtering were performed using the Genome Analysis Toolkit (GATK, v3.7-0). Variants were annotated using Annovar and variant effect predictor (VEP) software and interpreted following the American College of Medical Genetics and Genomics (ACMG) guidelines.

Sanger sequencing

The COL2A1 c.1584G>C mutation was confirmed via Sanger sequencing. Primers were designed using Primer3 software based on the mutation site. The forward primer sequence was 5'-TTTGCCTTGAGGACCAGCAT-3', and the reverse primer sequence was 5'-GTTGGGGCTGTTCTCACTCA-3'. PCR was used to amplify the target region, and the amplified products were screened using Mutation Surveyor software. Sanger sequencing was then performed on genomic DNA samples from family members to determine the variant status and inheritance pattern.

Protein structure analysis

To assess the potential structural impact of the detected mutation, three-dimensional models of both the wild-type and variant COL2A1 proteins were retrieved from the AlphaFold Protein Structure Database (DeepMind Technologies, Cambridge, UK; accessed on 14 August 2022 via https://github.com/deepmind/alphafold). The resulting protein structures were rendered and analyzed using PyMOL software (version 2.6; https://www.pymol.org/).

Cell culture

Human embryonic kidney cell line HEK-293 (RRID: CVCL_0045) and human chondrocytes cell line C28/I2 (RRID: CVCL_0187) were obtained from the Wuhan Viraltherapy Technologies Co., Ltd. (Wuhan, China). Cells were maintained as monolayer cultures in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 mg/mL streptomycin (Wuhan Servicebio Technology Co., Ltd., Wuhan, China) and maintain in 5 % CO₂ at 37 ℃.

Construction and transfection of COL2A1 mutant

Wild-type COL2A1 cDNA was reverse-transcribed from total RNA extracted from C28/I2 chondrocyte cells, which endogenously express COL2A1. COL2A1 mutant was generated by site-directed mutagenesis using the Mut Express II Fast Mutagenesis Kit V2 (Vazyme) from wild-type human COL2A1 cDNA and introduced to pLVX-C-EGFP-PGK-Puro vector (OBiO Technology, Shanghai, China). Mutagenic primers were designed to replace guanine (G) with cytosine (C) at position 1584 (forward primer: 5'-CCTGGCCTCCGCTACCTGGAC-3'; reverse primer: 5'-GTCCAGGTAGCGGAGGCCAGG-3'). Successful mutagenesis was confirmed by Sanger sequencing. Lentivirus was generated with the LipofectamineTM 3000 (Invitrogen, Waltham, MA, USA) using the pUC57 packaging vector and amplified in HEK293T cells. Multiplicity of infection (MOI) for C28/I2 cells transduction was optimized to levels at which green fluorescent protein (GFP) could be detected in 80–90% cells.

Real-time fluorescence quantitative polymerase chain reaction (qPCR)

Total RNA was extracted 7 days post-transfection using the RNeasy Mini Kit (Vazyme), following the manufacturer’s protocol. Residual genomic DNA contamination was eliminated by treating the RNA samples with DNase I (Takara, Shiga, Japan). RNA quality and concentration were assessed using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and integrity was confirmed via electrophoresis using UltraPure™ agarose (Invitrogen, Waltham, MA, USA).

cDNA was synthesized from 1 µg of RNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s guidelines. Real-time qPCR was performed using Taq Pro Universal SYBR qPCR Master Mix (Vazyme) on an Applied Biosystems™ ViiA™ 7 Dx Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

The following primer sequences (5' to 3') were used:

• COL2A1 forward: TCCAGATGACCTTCCTACGC;
• COL2A1 reverse: GGTATGTTTCGTGCAGCCAT;
• GAPDH forward: TCAAGAAGGTGGTGAAGCAGG;
• GAPDH reverse: TCAAAGGTGGAGGAGTGGGT.

Each qPCR reaction (20 µL) contained 10 µL of SYBR qPCR Master Mix (Vazyme), 0.4 µL of each primer (10 µM), 2 µL of cDNA, and 7.2 µL of RNase-free water. The cycling conditions were as follows:

• Initial denaturation at 95 ℃ for 30 seconds;
• 40 cycles of: (i) denaturation at 95 ℃ for 5 seconds; (ii) annealing/extension at 60 ℃ for 30 seconds.

A melting curve analysis was performed to confirm amplification specificity. Gene expression was analyzed using the 2^–ΔΔCt method, with GAPDH as the internal control. All reactions were performed in triplicate, and data are presented as mean ± standard deviation (SD).

Immunoblotting analysis

C28/I2 cells were lysed using a buffer composed of 10 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS, supplemented with a protease and phosphatase inhibitor cocktail (Wuhan Pinuofei Biological Co., Ltd., Wuhan, China). Lysates were centrifuged at 15,000 rpm for 20 minutes at 4 ℃, and the resulting supernatant was collected. Total protein concentrations were quantified using the Rapid Gold BCA Protein Assay Kit (Wuhan Pinuofei Biological Co., Ltd.).

For immunoblotting, proteins were resolved by SDS-PAGE on 4–15% Mini-PROTEAN TGX precast gradient gels (Millipore), and then transferred onto nitrocellulose membranes. Membranes were blocked with 2% non-fat milk in TBS containing 0.05% Tween-20 and incubated overnight at 4 ℃ with anti-COL2A1 antibody (1:1,000; Abways, Co. Ltd., Shanghai, China; Catalog No. BY0103), anti-Caspase 3 antibody (1:1,000; Cell Signaling Technology, Danvers, MA, USA; Catalog No. 9662), anti-β-actin antibody (1:1,000; Cell Signaling Technology, Danvers, MA, USA; Catalog No. 4967), and anti-GAPDH antibody (1:5,000; Abways, Co. Ltd., Shanghai, China; Catalog No. AB0036) as a loading control. Detection was performed using horseradish peroxidase (HRP)-conjugated species-specific secondary antibodies (Wuhan Servicebio Technology Co., Ltd., Wuhan, China) and enhanced chemiluminescence (ECL plus) detection reagent (Wuhan Pinuofei Biological Co., Ltd.). The chemiluminescent signals were captured using the LAS 3000 analyzer (Invitrogen, Waltham, MA, USA). Band intensities were quantified using ImageJ software. The experiment was biologically repeated three times.

Enzyme-linked immunosorbent assay (ELISA) assay

To measure the secretion of type II collagen in the cell supernatant, ELISA was performed using a commercially available type II collagen ELISA kit (JONLNBIO, Co. Ltd., Shanghai, China; Catalog No. JL15033). The supernatants from the cultured C28/I2 cells were collected after 7 days of transfection. The samples were processed according to the manufacturer’s instructions. The experiment was biologically repeated three times.

Fluorescence microscopy analysis of GFP expression

To assess the transduction efficiency, GFP expression in C28/I2 cells was evaluated using fluorescence microscopy. Images were captured using an Olympus FluoView FV1000 confocal microscope (Olympus, Japan). The proportion of GFP-positive cells was quantified using ImageJ software (version 1.53k) based on fluorescence intensity thresholds.

Cell Counting Kit-8 (CCK-8) assays

C28/I2 cells were seeded in 96-well plates at a density of 1×10⁴ cells per well overnight. Cells were treated with various concentrations of the compounds for 1 h. Cell viability was evaluated using a CCK-8 (Beyotime, Shanghai, China; Catalog No. C0038), and the absorbance at 450 nm was determined using an enzyme-labeled instrument (Varioskan LUX; Thermo Fisher Scientific, Waltham, MA, USA). The experiment was biologically repeated three times.

Statistical analysis

Statistical analysis was performed using an unpaired two-tailed Student’s t-test for comparisons between two groups and one-way analysis of variance (ANOVA) for comparisons among multiple groups. A P value of <0.05 was considered statistically significant. Data are presented as mean ± SD and were analyzed using GraphPad Prism 8 (GraphPad Software). No data point from the analysis is excluded.

Results

Clinical and genetic findings

The proband (Figure 1A; II-2), a male neonate, was born to a healthy, non-consanguineous couple following a full-term pregnancy and spontaneous vaginal delivery. His mother was gravida 4, para 2 (G4P2) with her first child being an 11-year-old healthy girl (Figure 1A; II-1). At birth, the proband exhibited significant respiratory distress, including groaning, tachypnea, and marked dyspnea. Physical examination revealed a relatively large head, depressed nasal bridge, widened interpupillary distance, micrognathia, shortened limbs, and noticeably short and broad fingers and toes (Figure 1B,1C). Bedside X-ray imaging demonstrated multiple punctate high-density areas at the tarsal bones, wrists, proximal femoral epiphyses, and sacral region, indicative of ossification abnormalities (Figure 1D). Additionally, the calcaneus and talus were not visualized, consistent with poor ossification (Figure 1D). Continuous positive airway pressure (CPAP) ventilation was immediately initiated. However, peripheral oxygen saturation remained critically low, fluctuating between 76% and 80%. Endotracheal intubation and mechanical ventilation were subsequently employed; however, the patient succumbed to severe, refractory respiratory failure on the fourth day of life.

Figure 1 Representative clinical features of the proband with achondrogenesis type II. (A) The pedigree of the investigated family. The arrow indicates the proband with ACG2. Carriers of the COL2A1 c.1584G>C mutation carriers are marked with semisolid color. The question mark indicates that genotype is not investigated. (B) Craniofacial features the proband. The proband exhibited distinctive craniofacial features characteristic of ACG2, including large head, a flattened nasal bridge, and micrognathia. (C) The proband displayed characteristic hand abnormalities, including short and broad fingers (brachydactyly) and limited joint mobility. (D) Bedside X-ray imaging results. (E) Sanger sequencing of the COL2A1 c.1584G>C. The results showed the proband and his father carries a heterozygous COL2A1 c.1584G>C variant. The blue arrow indicates the identified variant position. These images are published with the patient’s parents’ consent. ACG2, achondrogenesis type II.

To accurately identify the underlying cause of his death, WES and Sanger sequencing were conducted on the proband and his family. After excluding common and non-coding variants, WES revealed a single variant potentially responsible for the proband’s ACG2-like symptoms: a heterozygous missense mutation in the COL2A1 gene (NM_001844.5: c.1584G>C, p.Glu532Gln). Sanger sequencing confirmed the presence of this heterozygous mutation in the proband and his father, while no abnormalities were found in the mother’s COL2A1 gene (Figure 1E). The proband’s sister declined genetic testing, as per his parents’ decision.

COL2A1 c.1584G>C has been documented in the ClinVar database (Variation ID: 1716877) and the GnomAD database (SNV:12-47985814-C-G). Predictive functional analyses using SIFT, PolyPhen, REVEL, and ClinPred classified this variant as pathogenic. Based on these findings, the proband was diagnosed with ACG2, likely resulting from this rare inherited heterozygous COL2A1 c.1584G>C mutation.

Protein structural modeling

The COL2A1 c.1584G>C mutation involves the substitution of a negatively charged glutamic acid (Glu) with a neutral glutamine (Gln) at position 532 (Glu532) in the collagen type II alpha 1 chain. This Glu532Gln mutation likely results in structural changes that compromise the stability and function of type II collagen, contributing to the severe phenotype observed in the proband. To evaluate the structural impact of this mutation, AlphaFold was used to model the wild-type and mutant collagen alpha 1 chains. In the wild-type protein, Glu532 forms a network of hydrogen bonds crucial for stabilizing the collagen triple helix (Figure 2A):

• A chain Glu532 bonds with B chain Gly534 (2.8 Å) and Arg533 (2.7 and 3.1 Å);
• B chain Glu532 bonds with C chain Gly531 (2.8 Å) and Lys527 (2.6 Å);
• C chain Glu532 bonds with A chain Gly534 (2.8 Å) and Arg533 (2.7 and 3.3 Å).

Figure 2 Protein structural modeling analysis of the wild-type and mutant COL2A1 proteins. (A) The wild-type type II collagen protein. (B) The mutant type II collagen protein.

In the mutant protein, the substitution of Glu with Gln at position 532 alters above protein-protein network due to the loss of charge, resulting in fewer and weaker hydrogen bonds (Figure 2B):

• A chain Gln532 bonds with B chain Gly534 (2.8 Å) and Arg533 (2.9 Å);
• B chain Gln532 bonds with C chain Gly534 (2.9 Å) and Arg533 (2.9 Å);
• C chain Gln532 bonds with A chain Gly531 (2.8 Å).

These changes in hydrogen bond interactions and the loss of negative charge weaken the triple helix structure, likely impairing the stability and function of type II collagen.

Effects of the COL2A1 c.1584G>C mutation on type II collagen production

To assess the functional consequences of the COL2A1 c.1584G>C mutation, mutant (p.Glu532Gln) COL2A1 were constructed and overexpressed in C28/I2 human chondrocyte cells (Figure 3A). To verify the correct insertion of wild-type and mutant COL2A1 into the expression vector, recombinant plasmids were subjected to restriction enzyme digestion and analyzed by gel electrophoresis (Figure 3B). The resulting bands confirmed the presence and size of the inserted cDNA fragments. To ensure comparable transduction efficiency between groups, GFP expression was assessed, revealing similar fluorescence intensity of GFP-positive cells in both wild-type and mutant-transfected cells (Figure S1A,S1B), indicating consistent transduction efficiency across experiments. Importantly, western blot analysis of human C28/I2 chondrocytes transfected with mutant COL2A1 construct demonstrated significantly increased mutant protein expression levels compared to wild-type transfected cells (n=3) (Figure 3C,3D). ELISA analysis also revealed elevated levels of secreted type II collagen in the mutant-transfected cells, although the difference was not statistically significant compared to wild-type (n=3) (Figure 3E). To evaluate apoptosis, we also performed Caspase-3 Western blotting across all experimental groups. No significant differences in Caspase-3 levels were observed (Figure 3C), indicating that the mutation does not induce apoptosis under these conditions. However, this result does not exclude the possibility of transient or context-dependent apoptotic signaling, which may require dynamic assays (e.g., live-cell imaging or Annexin V staining) for full resolution. To further assess potential effects on cell viability, CCK-8 assays were performed. No significant differences in cell proliferation were detected between wild-type and mutant COL2A1-transfected cells (Figure S1C).

Figure 3 The effects of the COL2A1 c.1584G>C mutation. (A) Schematic of the empty vector control used in transfection experiments. (B) Restriction enzyme digestion of recombinant plasmids carrying either the WT or mutant COL2A1 cDNA inserts. (C) The Western blot analysis revealed that the type II collagen protein expression in human C28/I2 chondrocytes transfected with mutant COL2A1 construct (Glu532Gln) was higher than that in WT cells and vehicle control. In contrast, caspase-3 levels remained unchanged between the two groups, suggesting that the mutation did not induce significant apoptotic activity under the experimental conditions. (D) The band signal strength of type II collagen expressed as a ratio to GAPDH (n=3). (E) The ELISA analysis results of the secreted type II collagen protein expression in human C28/I2 chondrocytes transfected with mutant COL2A1 construct and in WT cells (n=3). n.s., not significant; **, P<0.005; ***, P<0.001; ****, P<0.0001. ELISA, enzyme-linked immunosorbent assay; WT, wild-type.

Discussion

The COL2A1 gene consists of 54 exons spanning 31.5 kb, with a coding sequence (CDS) of 4,464 bp encoding a protein of 1,487 amino acids and a molecular weight of 134.4 kDa (1). Notably, nucleotides 601–3642 of the CDS encode the triple-helical domain of type II collagen, characterized by a Gly-X-Y repeating sequence, where Gly represents glycine, and X and Y denote other amino acids (1,3). This Gly-X-Y motif is crucial for the structural stability and intermolecular interactions of collagen molecules (1,3). In this study, we report a heterozygous missense mutation in the COL2A1 gene, c.1584G>C (p.Glu532Gln), identified in a newborn diagnosed with ACG2. This mutation resides within the triple-helical domain, highlighting its potential impact on the integrity and function of type II collagen. Importantly, structural modeling using AlphaFold2 revealed that the c.1584G>C mutation disrupts the triple-helix conformation of normal type II collagen.

In our analysis, while the expression total level of the mutant protein was increased, its secretion was not proportionally elevated. This discrepancy suggests that the mutation may disrupt the normal secretion process of type II collagen. Importantly, GFP fluorescence analysis showed no significant differences in transduction efficiency between cells transfected with wild-type and mutant constructs, indicating that the observed secretion differences are unlikely due to variations in transfection levels. Mutations affecting the Gly-X-Y motif, such as p.Gly1170Ser and p.Arg1192Cys, are known to impair the proper folding or assembly of the triple-helical structure, which is essential for efficient secretion (7,8). Misfolded or partially assembled collagen molecules are often retained within the endoplasmic reticulum (ER), potentially activating ER stress or degradation pathways to manage the accumulation of defective proteins (7-9). These mechanisms likely underline the observed discrepancy between intracellular expression and extracellular secretion levels. Consequently, defective secretion could result in reduced extracellular matrix deposition of type II collagen, contributing to the severe phenotypic manifestations characteristic of ACG2. Whether similar mechanisms contribute to the secretion defect potentially associated with the c.1584G>C mutation remains to be investigated. Further investigations, such as ER retention assays and evaluations of intracellular accumulation, are warranted to confirm these findings and elucidate the molecular mechanisms driving the secretion defect associated with the COL2A1 c.1584G>C mutation.

Clinically, the proband presented with hallmark features of ACG2, including severe micromelia, a hypoplastic thoracic cavity, and poor skeletal ossification. These findings align with the pathogenic mechanisms of type II collagenopathies, where impaired matrix integrity leads to severe developmental anomalies (1,4). The inheritance of the COL2A1 c.1584G>C mutation from the proband’s asymptomatic father raises questions about the mechanisms underlying incomplete penetrance in COL2A1-related disorders. While mild or subclinical phenotypes have been reported in other collagenopathies, the lack of symptoms in the father is atypical for COL2A1 mutations associated with severe skeletal dysplasias such as ACG2 (4,10,11). Possible contributing factors include genetic modifiers, environmental influences, or epigenetic regulation, though further studies are required to elucidate these mechanisms. The use of WES was critical in identifying this mutation, emphasizing its value in diagnosing rare genetic conditions, particularly those with atypical inheritance patterns.

Despite the insights provided by this study, several limitations must be acknowledged. First, the COL2A1 c.1584G>C mutation and its associated phenotype were identified in only a single family, underscoring the need for replication in larger and ethnically diverse cohorts to validate its pathogenicity. Second, while structural modeling and in vitro experiments—including analyses of COL2A1 protein expression, cell apoptosis, and proliferation—support a functional impact of the mutation, the precise molecular mechanisms underlying its effect on type II collagen processing remain to be elucidated. For instance, we did not evaluate ER retention or stress markers (e.g., BiP, CHOP), nor did we perform immunofluorescence to assess intracellular accumulation or extracellular matrix deposition. Such analyses would provide critical insights into misfolding-induced pathogenic cascades. Finally, while structural and in vitro data strongly suggest impaired collagen function, in vivo studies using animal models will be essential to elucidate tissue-specific effects and clarify genotype–phenotype correlations, particularly in the context of variable expressivity.

Conclusions

In conclusion, our findings identify a COL2A1 mutation and provide mechanistic insights into its role in the pathogenesis of ACG2. This work contributes to the broader understanding of type II collagenopathies and underscores the importance of integrating genetic, structural, and functional approaches in the study of rare congenital disorders.

Acknowledgments

Special thanks to Mr. Yang Hao from Hangzhou Mei’aiying Biomedical Technology Co., Ltd. (Med.AI) for his invaluable technical support and professional guidance.

Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-79/rc

Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-79/dss

Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-79/prf

Funding: None.

Conflicts of Interest: Both authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-79/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was supported by the Ethics Committee of the Children’s Hospital, Zhejiang University School of Medicine (No. 2022-IRBAL-98). This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. Written informed consent was obtained from the patient’s legal guardians.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Deng H, Huang X, Yuan L. Molecular genetics of the COL2A1-related disorders. Mutat Res Rev Mutat Res 2016;768:1-13. [Crossref] [PubMed]
2. Zhang B, Zhang Y, Wu N, et al. Integrated analysis of COL2A1 variant data and classification of type II collagenopathies. Clin Genet 2020;97:383-95. [Crossref] [PubMed]
3. Wu M, Cronin K, Crane JS. Biochemistry, Collagen Synthesis. [Updated 2023 Sep 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 Jan. Available online: https://www.ncbi.nlm.nih.gov/books/NBK507709/
4. Gregersen PA, Savarirayan R. Type II Collagen Disorders Overview. 2019 Apr 25 [Updated 2024 Oct 24]. In: Adam MP, Feldman J, Mirzaa GM, et al. editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2025. Available online: https://www.ncbi.nlm.nih.gov/books/NBK540447/
5. Barat-Houari M, Sarrabay G, Gatinois V, et al. Mutation Update for COL2A1 Gene Variants Associated with Type II Collagenopathies. Hum Mutat 2016;37:7-15. [Crossref] [PubMed]
6. Kobayashi Y, Ito Y, Taniguchi K, et al. Novel missense COL2A1 variant in a fetus with achondrogenesis type II. Hum Genome Var 2022;9:40. [Crossref] [PubMed]
7. Liang G, Lian C, Huang D, et al. Endoplasmic reticulum stress-unfolding protein response-apoptosis cascade causes chondrodysplasia in a col2a1 p.Gly1170Ser mutated mouse model. PLoS One 2014;9:e86894. [Crossref] [PubMed]
8. Chung HJ, Jensen DA, Gawron K, et al. R992C (p.R1192C) Substitution in collagen II alters the structure of mutant molecules and induces the unfolded protein response. J Mol Biol 2009;390:306-18. [Crossref] [PubMed]
9. Esapa CT, Hough TA, Testori S, et al. A mouse model for spondyloepiphyseal dysplasia congenita with secondary osteoarthritis due to a Col2a1 mutation. J Bone Miner Res 2012;27:413-28. [Crossref] [PubMed]
10. Tompson SW, Johnson C, Abbott D, et al. Reduced penetrance in a large Caucasian pedigree with Stickler syndrome. Ophthalmic Genet 2017;38:43-50. [Crossref] [PubMed]
11. Demal TJ, Scholz T, Schüler H, et al. Expanding the clinical spectrum of COL2A1 related disorders by a mass like phenotype. Sci Rep 2022;12:4489. [Crossref] [PubMed]