Expression and significance of miR-9-5p and GCH1 in neonates with bronchopulmonary dysplasia

Introduction

Bronchopulmonary dysplasia (BPD) is a prevalent and severe respiratory complication in preterm infants, remaining a major focus of research in neonatal medicine. With advances in contemporary neonatal care, the survival rate of preterm infants has improved substantially. However, the incidence of BPD remains similar or is even increasing (1). A 2024 systematic review and meta-analysis by Moreira et al. indicated that the global incidence of BPD among very low birth weight (VLBW) infants or extremely preterm infants ranges from 21% to 35% (2). Moreover, BPD is associated with diverse short- and long-term complications affecting the respiratory, cardiovascular, and nervous systems, severely compromising the quality of life and long-term prognosis of preterm infants (3,4).

The pathogenesis of BPD is highly complex, resulting from the interplay of multiple pathological cascades including oxidative stress, inflammatory responses, and impaired lung development (5). Regarding oxidative stress, the immature lung tissue and underdeveloped antioxidant defense system of preterm infants render them prone to excessive reactive oxygen species (ROS) accumulation upon stimuli such as hyperoxic exposure. This ROS overproduction induces lung cell damage and apoptosis, disrupting the normal development of alveoli and pulmonary vasculature (6). Inflammatory responses also play a pivotal role in BPD progression, involving various inflammatory cells and cytokines [e.g., tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6)]. The inflammatory cascades mediated by these factors can cause lung tissue injury and fibrosis (7). Additionally, impaired lung development is a hallmark pathological feature of BPD, characterized by reduced alveolar count, increased alveolar volume, and pulmonary microvascular dysplasia, which significantly impair pulmonary gas exchange and blood circulation functions (8).

Recent advances in molecular biology have highlighted the potential roles of non-coding RNAs and key enzymatic proteins in BPD pathogenesis. MicroRNAs (miRNAs) are endogenous non-coding small RNAs (approximately 22 nucleotides in length) that regulate gene expression at the post-transcriptional level via complementary base pairing with target messenger RNA (mRNA) molecules (9). During BPD pathogenesis, the expression profiles of specific miRNAs undergo significant alterations, which may modulate lung development and repair by regulating target gene expression, thereby exerting crucial roles in BPD initiation and progression (10-13). miR-9-5p plays a significant role in numerous physiological functions and is involved in the pathogenesis of lung diseases, including asthma (14) and acute lung injury (15). Notably, miR-9-5p has been shown to suppress pro-fibrogenic transformation of fibroblasts and prevent organ fibrosis by targeting NOX4 (NADPH oxidase 4) and TGFBR2 (TGF-β receptor type II) (16). However, there are currently no clinical studies exploring the role of miR-9-5p in BPD.

Guanosine triphosphate cyclohydrolase 1 (GCH1), the rate-limiting enzyme in the de novo synthesis pathway of tetrahydrobiopterin (BH4), plays a pivotal role in endogenous biopterin metabolism and nitric oxide (NO) synthesis (17). BH4 serves as an essential cofactor for nitric oxide synthases (NOS), critical for maintaining NOS activity and stable NO production (18). Under conditions of low BH4 bioavailability, NOS becomes “uncoupled” and produces superoxide (O₂⁻) instead of NO, leading to the formation of peroxynitrite (ONOO⁻), a highly reactive oxidant that can further oxidize BH4 and propagate NOS uncoupling (19). As a key signaling molecule, NO is indispensable for physiological processes such as pulmonary vasodilation, inflammatory regulation, and cell proliferation (20,21). In the pathological context of BPD, dysregulated GCH1 expression may lead to inadequate BH4 biosynthesis, impairing NO production, which further perturbs pulmonary vascular tone, exacerbates inflammatory responses, and hinders lung tissue development and repair.

Current BPD diagnosis primarily relies on clinical manifestations, oxygen requirement assessment, and chest imaging findings. However, these diagnostic approaches have some limitations that hinder early and accurate identification of the disease and have limited ability to predict BPD severity (22). Several novel biomarkers have been investigated for early BPD prediction, including Intercellular Adhesion Molecule-1 (ICAM-1) (23), amino-terminal pro-brain natriuretic peptide (NT-proBNP) (24), serum mediator complex subunit 1 (MED1), and serum peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1α) (25) in blood and lipid profiles in the tracheal aspirate (26). However, none of these biomarkers have been consistently validated across different populations or integrated into routine clinical practice. The heterogeneity in study designs, small sample sizes, lack of large-scale validation, and variability in assay methods have hindered the clinical translation of these potential biomarkers. Given these limitations of current diagnostic methods, there is an urgent need to identify novel and reliable biomarkers that can enable early detection of BPD before the disease becomes clinically apparent. Such biomarkers would facilitate timely intervention, improve risk stratification, and potentially guide personalized therapeutic strategies to reduce the incidence and severity of BPD.

In this study, we examined miR-9-5p and GCH1 expression in the blood of neonates diagnosed with BPD compared to non-BPD controls. We hypothesis that miR-9-5p expression would be significantly enhanced in infants with BPD, and GCH1 would be significantly decreased in BPD ones, indicating their involvement in the progress of the disease. To evaluate this hypothesis, we harvested peripheral blood samples from 30 neonates diagnosed with BPD and 52 matched controls, and quantified miR-9-5p expression using quantitative real-time polymerase chain reaction (qRT-PCR) and GCH1 expression with enzyme-linked immunosorbent assay (ELISA) kit. We present this article in accordance with the STARD reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-1-929/rc).

Methods

Study subject selection and grouping

Initially, 90 preterm infants with a gestational age <32 weeks and birth weight <1,500 g admitted to the Neonatology Department of Nantong University Affiliated Hospital between January 2024 and September 2025 were enrolled. After excluding 8 cases meeting predefined exclusion criteria (severe congenital malformations, complex hereditary metabolic diseases, death within 28 postnatal days, parental withdrawal from all treatment, or transfer to other hospitals), 82 preterm infants were ultimately included. (Figure 1)

Figure 1 Flow chart of the infant selection process.

Inclusion criteria: (I) gestational age at birth <32⁺⁰ weeks and birth weight <1,500 g; (II) underwent blood biochemical examinations after birth; (III) complete clinical data available; (IV) guardians provided written informed consent.

Exclusion criteria: (I) severe congenital malformations; (II) complex hereditary metabolic diseases; (III) death within 28 postnatal days, parental withdrawal from all treatment, or transfer to other hospitals.

Eligible infants were stratified into the BPD group and non-BPD group according to the 2001 National Institute of Child Health and Human Development (NICHD) diagnostic criteria for BPD (27), with 30 cases in the BPD group (including 21 classified as mild, 7 as moderate, and 2 as severe BPD) and 52 cases in the non-BPD group (Figure 1). Detailed definition and diagnostic criteria of neonatal diseases refers to the 5th edition of practical neonatology (28).

Sample size estimation

In a preliminary study, blood samples from 10 BPD and 10 non-BPD patients were collected to compare miR-9-5p expression (BPD group: 0.0093±0.0033; non-BPD group: 0.0072±0.0029). Sample size calculation was performed using PASS 15.0 (the NCSS, LLC, Kaysville, UT, USA) software with the formula: N = [(Zα/2 + Zβ)² × (SD₁² + SD₂²)/(µ₁ − µ₂)²]. The calculation was based on 80% power at a two-sided significance level of 0.05. The calculation suggested 19 samples per group, but a larger sample size was collected to enhance result robustness.

Sample collection and analysis

Peripheral venous blood (5 mL) was collected from infants on postnatal day 28, immediately placed into Ethylene Diamine Tetraacetic Acid (EDTA)-anticoagulated vacuum blood collection tubes, and centrifuged at 1,500 rpm for 10 minutes at 4 ℃ to separate plasma. Plasma samples were used for both miR-9-5p and GCH1 measurements. Isolated plasma was stored at −80 ℃ until GCH1 detection to prevent RNA degradation and protein activity alterations.

Real-time quantitative polymerase chain reaction (RT-qPCR) assay

Total RNA was isolated from plasma using TRIzol reagent (cat. no. 15596026; Invitrogen, Shanghai, China). Reverse transcription (RT) was conducted with a miRNA-specific RT kit (cat. no. 638315; Takara Bio Inc., Dalian, China), followed by real-time PCR with a miRNA quantitative detection kit (cat. no. 638314; Takara Bio Inc., Dalian, China).

RT reaction conditions: 37 ℃ for 1 h, then 85 ℃ for 5 min (reverse transcriptase inactivation). Real-time PCR was performed in a 25 µL system with conditions: initial denaturation at 95 ℃ for 10 s; 40 cycles of 95 ℃ for 5 s and 60 ℃ for 20 s; melt curve analysis (95 ℃ for 60 s, 55 ℃ for 30 s, 95 ℃ for 30 s).

Primers were designed using Primer3 software (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) and synthesized by Takara Bio Inc. (Dalian, China). The primer sequences are listed below: miR-9-5p: AGTATGTCGATCTATTGGTTTCT; U6 forward: CTCGCTTCGGCAGCACA; U6 reverse: AACGCTTCACGAATTTGCGT.

Relative miR-9-5p expression was calculated using the 2^−ΔΔCt method with U6 snRNA as the internal reference, and data were analyzed by SDS 7500 software (Applied Biosystems, Foster City, CA, USA).

ELISA

GCH1 levels were quantified using a commercial ELISA kit (Yueteng, YT-H12026, Yueteng Biotechnology Co., Ltd., Tianjin, China) according to the manufacturer’s instructions.

Ethical considerations

The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Affiliated Hospital of Nantong University (No. 2025-K180), and informed consent was obtained from all legal guardians.

Statistical analysis

Continuous data with normal distribution were presented as mean ± standard deviation and compared by independent samples t-test; non-normal continuous data were described as median [interquartile range, M (P25, P75)] and compared by nonparametric tests. Categorical data were expressed as n (%) and compared by Chi-squared (χ²) test. Multiple logistic regression analysis was performed to identify independent predictors of BPD. Receiver operating characteristic (ROC) curves were used to analyze the diagnostic efficiency and the optimal cut-off value. Spearman correlation analysis was used for correlation analysis. A two-tailed P<0.05 was considered statistically significant. Analyses were performed using SPSS 24.0 software (IBM Corp., Armonk, NY, USA), and figures were generated with GraphPad Prism 10 (GraphPad Software, LLC, San Diego, CA, USA).

Results

General characteristics

No significant differences were observed in general clinical characteristics (gestational age, gender, birth weight, mode of delivery, small for gestational age (SGA), prenatal corticosteroid administration, maternal diabetes/hypertension history) between the BPD and non-BPD group, ensuring comparability (Table 1).

Clinical features

In terms of comorbidities, no significant differences were found in the proportion of preterm infants with neonatal respiratory distress syndrome (NRDS), periventricular or intraventricular hemorrhage (PVH-IVH) (III–IV), necrotizing enterocolitis (NEC), patent ductus arteriosus (PDA), hemodynamically significant patent ductus arteriosus (hs-PDA), and persistent pulmonary hypertension (PPHN) between the two groups (all P>0.05). However, the BPD group had significantly higher proportions of neonatal asphyxia, neonatal pneumonia, neonatal sepsis, retinopathy of prematurity (ROP), and neonatal anemia (all P<0.05) (Table 2). After correcting for confounding factors using multiple regression, neonatal asphyxia and neonatal sepsis were identified as independent risk factors for BPD (both P<0.05) (Table 3).

In terms of treatments, no significant differences were found in proportions of non-invasive ventilator use, inhaled nitric oxide and breastfeeding (all P>0.05). However, the BPD group had significantly higher proportions of invasive ventilator use, red blood cell transfusion, higher exposure to oxygen concentrations >30%, longer duration of invasive ventilation, non-invasive ventilation, and oxygen inhalation (all P<0.05) (Table 2).

miR-9-5p and GCH1 levels in BPD and control groups

Significant differences in miR-9-5p and GCH1 expression were observed between the two groups (Figure 2). The BPD group had notably higher miR-9-5p expression [0.0087±0.0021 vs. 0.0064±0.0025, P<0.001, 95% confidence interval (CI): 0.0015–0.0031] and significantly lower GCH1 expression (0.0732±0.0074 vs. 0.2356±0.0609, P<0.001, 95% CI: −0.2055 to −0.1193).

Figure 2 miR-9-5p and GCH1 levels in BPD and control groups. (A) miR-9-5p expression was significantly higher in the BPD group compared to the non-BPD group (0.0087±0.0021 vs. 0.0064±0.0025, P<0.001, 95% CI: 0.0015–0.0031). (B) GCH1 levels were significantly lower in the BPD group compared to the non-BPD group (0.0732±0.0074 vs. 0.2356±0.0609, P<0.001, 95% CI: −0.2055 to −0.1193). ***, P<0.001. BPD, bronchopulmonary dysplasia; CI, confidence interval; GCH1, guanosine triphosphate cyclohydrolase 1.

Predictive capability of miR-9-5p and GCH1 for BPD

ROC curve analysis showed that the area under the curve (AUC) for miR-9-5p and GCH1 is 0.833 (95% CI: 0.742–0.924) and 0.737 (95% CI: 0.629–0.845), respectively. The optimal cutoff values for differentiating BPD were 0.007 (sensitivity: 0.623; specificity: 0.767) for miR-9-5p and 0.074 (sensitivity: 0.632; specificity: 0.750) for GCH1 (Figure 3).

Figure 3 ROC curve analysis for BPD prediction. (A) miR-9-5p (AUC =0.833, 95% CI: 0.742–0.924); (B) GCH1 (AUC =0.737, 95% CI: 0.629–0.845). AUC, area under the curve; BPD, bronchopulmonary dysplasia; CI, confidence interval; GCH1, guanosine triphosphate cyclohydrolase 1; ROC, receiver operating characteristic.

Correlation between miR-9-5p and GCH1 in BPD patients

Spearman correlation analysis revealed a strong negative correlation between miR-9-5p and GCH1 in BPD patients (r=−0.8967, P<0.001). The linear regression equation was y=−0.8967×x +0.066 (standard error: 0.001; 95% CI: 0.0255–0.0305; F=252.713, P<0.001), confirming a robust linear relationship (Figure 4).

Figure 4 Correlation between miR-9-5p expression and GCH1 levels in BPD patients. Spearman correlation analysis revealed a strong negative correlation (r=−0.8967, P<0.0001). BPD, bronchopulmonary dysplasia; GCH1, guanosine triphosphate cyclohydrolase 1.

Discussion

Neonatal BPD is the most prevalent chronic respiratory disease in preterm infants, impacting survival rate and associating with long-term respiratory sequelae such as asthma, chronic obstructive pulmonary disease and neurodevelopmental delays like cerebral palsy (29). Identifying early biomarkers for BPD is crucial for reducing its incidence and disability rates.

BPD pathogenesis involves abnormal repair of immature lungs after multiple insults (30). Consistent with prior findings (31), our data showed BPD infants had longer oxygen inhalation duration, higher exposure to oxygen concentrations >30%, higher mechanical ventilation rates/durations, and increased neonatal asphyxia, sepsis and red blood cell transfusion rates. High-concentration oxygen induces BPD via oxidative stress, inflammation, and impaired lung development (7), while mechanical ventilation causes lung injury through barotrauma, volutrauma, and inflammatory activation (32).

After correcting for confounding factors using multiple regression, neonatal asphyxia and sepsis were identified as independent risk factors for BPD. Hypoxic acidosis triggers a cascade of pulmonary damage including structural injury to alveolar and vascular tissues, impaired surfactant production, and pathological changes of edema and hyaline membrane formation (33). On the other hand, hypoxia induces the release of a large number of inflammatory factors, leading to chronic inflammation and abnormal repair of lung tissue (34). Multiple studies have shown that neonatal sepsis is an independent risk factor for BPD (31), possible mechanisms include: pathogens and their toxins directly damaging lung tissue cells, inducing chronic inflammatory injury, and interfering with normal lung development processes, these three pathways collectively lead to permanent structural and functional damage to the lungs (35). Clinically, optimizing oxygen/ventilation strategies, timely and standardized resuscitation for asphyxia and multidisciplinary interventions are critical to mitigate such injuries.

Abnormal expression of miR-9-5p and GCH1 in BPD pathogenesis

To our knowledge, this is the first study to clearly demonstrate significant abnormalities in miR-9-5p and GCH1 expression in BPD infants. miR-9-5p upregulation and GCH1 downregulation in peripheral blood are closely associated with BPD pathological progression.

At the molecular level, miR-9-5p may specifically target GCH1 mRNA to regulate its stability or translation, suppressing BH4 synthesis (17). As an essential coenzyme for NOS, BH4 maintains NOS activity and stable NO production (36). High miR-9-5p expression may inhibit GCH1, reducing BH4 synthesis, which impairs NOS activity and NO production (20). Insufficient NO disrupts pulmonary vascular tone (causing vasoconstriction and ischemia-hypoxia), exacerbates inflammatory cell infiltration (37-39), and impairs alveolar and vascular development, which are hallmark features of BPD (40).

As a key enzyme in phenylalanine hydroxylase coenzyme synthesis, GCH1 downregulation also contributes to BPD progression by limiting BH4 synthesis. Beyond regulating NO production, BH4 exerts antioxidant effects by scavenging free radicals, alleviating oxidative stress and ferroptosis (41). Insufficient BH4 leads to ROS accumulation, attacking biological macromolecules and activating inflammatory pathways, further exacerbating BPD (42).

Advantages of miR-9-5p as a novel BPD diagnostic biomarker

ROC curve analysis showed miR-9-5p had an AUC of 0.833, significantly higher than GCH1’s 0.737, indicating superior accuracy in distinguishing BPD infants. At a cutoff value of 0.007, miR-9-5p achieved a sensitivity of 62.3% and specificity of 76.7%, reducing misdiagnosis and missed diagnosis (vs. GCH1: sensitivity 63.2%, specificity 75.0%). Notably, miR-9-5p is stable in bodily fluids, enabling quantitative analysis via simple blood tests with minimal infant trauma, high operability, and rapid results, which is conducive to clinical promotion.

Further integrating miR-9-5p with clinical parameters (e.g., gestational age, oxygen therapy duration) via multivariate analysis is expected to establish a more accurate diagnostic model, improving early BPD diagnosis and infant prognosis.

Biological significance of the negative correlation between miR-9-5p and GCH1

The strong negative correlation (r=−0.8967) suggests that miR-9-5p and GCH1 form a key regulatory axis in BPD pathogenesis. Targeted intervention on this axis may represent a potential treatment strategy: miR-9-5p inhibitors could alleviate GCH1 suppression, upregulating BH4 and NO synthesis to improve pulmonary vascular function and promote lung repair; GCH1 agonists may achieve similar effects. However, these potential therapeutic strategies require further validation in preclinical and clinical studies.

Study limitations

There are several limitations in this study. First, the small sample size (30 BPD, 52 non-BPD infants) and single-center design may introduce biases, limiting generalizability. Validation in larger, multi-regional, and multi-ethnic cohorts is required. Second, associations of miR-9-5p/GCH1 with BPD severity and long-term prognosis were not explored. Third, we did not assess the potential influence of breastmilk-derived exosomal miRNAs on circulating miR-9-5p levels, which represents an important area for future investigation. Fourth, the use of 2001 NICHD diagnostic criteria instead of the newer 2019 Jensen criteria may limit comparability with recent literature. Future multi-center cohort studies should address these gaps.

Conclusions

miR-9-5p is a valuable biomarker for early BPD diagnosis, providing insights into pathogenesis and informing early detection and intervention strategies.

Acknowledgments

We sincerely thank all participating families and infants, as well as the hospital’s medical ethics committee for ethical review and approval.

Footnote

Reporting Checklist: The authors have completed the STARD reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-1-929/rc

Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-1-929/dss

Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-2025-1-929/prf

Funding: The study was supported by Nantong Social and People’s Livelihood Science and Technology Program Project (Nos. MSZ2023094, MSZ2023022); and Nantong University Affiliated Hospital Research-Oriented Physician Development Fund (No. YJXYY202204-2-YSB25).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-2025-1-929/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Affiliated Hospital of Nantong University (No. 2025-K180), and informed consent was obtained from all legal guardians.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Jeon GW, Oh M, Chang YS. Increased bronchopulmonary dysplasia along with decreased mortality in extremely preterm infants. Sci Rep 2025;15:8720. [Crossref] [PubMed]
2. Moreira A, Noronha M, Joy J, et al. Rates of bronchopulmonary dysplasia in very low birth weight neonates: a systematic review and meta-analysis. Respir Res 2024;25:219. [Crossref] [PubMed]
3. McGlynn JR, Aoyama BC, Collaco JM, et al. Family history of asthma influences outpatient respiratory outcomes in children with BPD. Pediatr Pulmonol 2021;56:3265-72. [Crossref] [PubMed]
4. Katz TA, Vliegenthart RJS, Aarnoudse-Moens CSH, et al. Severity of Bronchopulmonary Dysplasia and Neurodevelopmental Outcome at 2 and 5 Years Corrected Age. J Pediatr 2022;243:40-46.e2. [Crossref] [PubMed]
5. El-Atawi K, Abdul Wahab MG, Alallah J, et al. Beyond Bronchopulmonary Dysplasia: A Comprehensive Review of Chronic Lung Diseases in Neonates. Cureus 2024;16:e64804. [Crossref] [PubMed]
6. Teng M, Wu TJ, Jing X, et al. Temporal Dynamics of Oxidative Stress and Inflammation in Bronchopulmonary Dysplasia. Int J Mol Sci 2024;25:10145. [Crossref] [PubMed]
7. Wu TJ, Jing X, Teng M, et al. Role of Myeloperoxidase, Oxidative Stress, and Inflammation in Bronchopulmonary Dysplasia. Antioxidants (Basel) 2024;13:889. [Crossref] [PubMed]
8. Baraldi E, Filippone M. Chronic lung disease after premature birth. N Engl J Med 2007;357:1946-55. [Crossref] [PubMed]
9. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281-97. [Crossref] [PubMed]
10. Nardiello C, Morty RE. MicroRNA in late lung development and bronchopulmonary dysplasia: the need to demonstrate causality. Mol Cell Pediatr 2016;3:19. [Crossref] [PubMed]
11. Lal CV, Olave N, Travers C, et al. Exosomal microRNA predicts and protects against severe bronchopulmonary dysplasia in extremely premature infants. JCI Insight 2018;3:e93994. [Crossref] [PubMed]
12. Koussa S, Dombkowski A, Cukovic D, et al. MicroRNA dysregulation in the heart and lung of infants with bronchopulmonary dysplasia. Pediatr Pulmonol 2023;58:1982-92. [Crossref] [PubMed]
13. Maeda H, Li X, Go H, et al. miRNA Signatures in Bronchopulmonary Dysplasia: Implications for Biomarkers, Pathogenesis, and Therapeutic Options. Front Biosci (Landmark Ed) 2024;29:271. [Crossref] [PubMed]
14. Xu C, Huang H, Zou H, et al. The miR-9-5p/KLF5/IL-1β Axis Regulates Airway Smooth Muscle Cell Proliferation and Apoptosis to Aggravate Airway Remodeling and Inflammation in Asthma. Biochem Genet 2024;62:3996-4010. [Crossref] [PubMed]
15. Alatawi FS, Omran AME, Rashad E, et al. Rutin attenuates bleomycin-induced acute lung injury via miR-9-5p mediated NF-κB signaling inhibition: network pharmacology analysis and experimental evidence. Front Pharmacol 2025;16:1522690. [Crossref] [PubMed]
16. Fierro-Fernández M, Busnadiego Ó, Sandoval P, et al. miR-9-5p suppresses pro-fibrogenic transformation of fibroblasts and prevents organ fibrosis by targeting NOX4 and TGFBR2. EMBO Rep 2015;16:1358-77. [Crossref] [PubMed]
17. Fanet H, Capuron L, Castanon N, et al. Tetrahydrobioterin (BH4) Pathway: From Metabolism to Neuropsychiatry. Curr Neuropharmacol 2021;19:591-609. [Crossref] [PubMed]
18. Gupta P, Kumar R. GTP cyclohydroxylase1 (GCH1): Role in neurodegenerative diseases. Gene 2023;888:147749. [Crossref] [PubMed]
19. Janaszak-Jasiecka A, Płoska A, Wierońska JM, et al. Endothelial dysfunction due to eNOS uncoupling: molecular mechanisms as potential therapeutic targets. Cell Mol Biol Lett 2023;28:21. [Crossref] [PubMed]
20. Roberts JD Jr. Nitric oxide regulation of fetal and newborn lung development and function. Nitric Oxide 2024;147:13-25. [Crossref] [PubMed]
21. Jin Z, Jiang MM, Lee B. Nitric oxide is required for lung alveolarization revealed by deficiency of argininosuccinate lyase. Hum Mol Genet 2023;33:33-7. [Crossref] [PubMed]
22. Sun L, Zhang H, Bao Y, et al. Long-Term Outcomes of Bronchopulmonary Dysplasia Under Two Different Diagnostic Criteria: A Retrospective Cohort Study at a Chinese Tertiary Center. Front Pediatr 2021;9:648972. [Crossref] [PubMed]
23. Sahni M, Yeboah B, Das P, et al. Novel biomarkers of bronchopulmonary dysplasia and bronchopulmonary dysplasia-associated pulmonary hypertension. J Perinatol 2020;40:1634-43. [Crossref] [PubMed]
24. Wang H, Yan D, Wu Z, et al. Predictive values of clinical data,molecular biomarkers, and echocardiographic measurements in preterm infants with bronchopulmonary dysplasia. Front Pediatr 2022;10:1070858. [Crossref] [PubMed]
25. Li M, Sun W, Fu C, et al. Predictive value of serum MED1 and PGC-1α for bronchopulmonary dysplasia in preterm infants. BMC Pulm Med 2024;24:363. [Crossref] [PubMed]
26. Ma Y, Wu W, Bao Z, et al. Lipidomic signatures of tracheal aspirate diagnostic biomarkers in preterm infants with bronchopulmonary dysplasia. Eur J Pediatr 2025;184:731. [Crossref] [PubMed]
27. Jobe AH, Bancalari E. Bronchopulmonary dysplasia. Am J Respir Crit Care Med 2001;163:1723-9. [Crossref] [PubMed]
28. Zhang Y, Sun C, Wang B, et al. Brain-Derived Exosomal miR-9-5p Induces Ferroptosis in Traumatic Brain Injury-Induced Acute Lung Injury by Targeting Scd1. CNS Neurosci Ther 2024;30:e70189. [Crossref] [PubMed]
29. Homan TD, Nayak RP. Short- and Long-Term Complications of Bronchopulmonary Dysplasia. Respir Care 2021;66:1618-29. [Crossref] [PubMed]
30. Kalikkot Thekkeveedu R, Guaman MC, Shivanna B. Bronchopulmonary dysplasia: A review of pathogenesis and pathophysiology. Respir Med 2017;132:170-7. [Crossref] [PubMed]
31. Xiong P, Li L, Yu Z, et al. Risk factors for bronchopulmonary dysplasia in preterm infants: a systematic review and meta-analysis. PeerJ 2025;13:e20202. [Crossref] [PubMed]
32. van Kaam AH. Optimal Strategies of Mechanical Ventilation: Can We Avoid or Reduce Lung Injury? Neonatology 2024;121:570-5.
33. Sweet DG, Carnielli VP, Greisen G, et al. European Consensus Guidelines on the Management of Respiratory Distress Syndrome: 2022 Update. Neonatology 2023;120:3-23. [Crossref] [PubMed]
34. Okazaki K, Nakamura S, Koyano K, et al. Neonatal asphyxia as an inflammatory disease: Reactive oxygen species and cytokines. Front Pediatr 2023;11:1070743. [Crossref] [PubMed]
35. Salimi U, Dummula K, Tucker MH, et al. Postnatal Sepsis and Bronchopulmonary Dysplasia in Premature Infants: Mechanistic Insights into "New BPD". Am J Respir Cell Mol Biol 2022;66:137-45. [Crossref] [PubMed]
36. Feng Y, Feng Y, Gu L, et al. The Critical Role of Tetrahydrobiopterin (BH4) Metabolism in Modulating Radiosensitivity: BH4/NOS Axis as an Angel or a Devil. Front Oncol 2021;11:720632. [Crossref] [PubMed]
37. Tanaka M, Abe K, Oka M, et al. Inhibition of nitric oxide synthase unmasks vigorous vasoconstriction in established pulmonary arterial hypertension. Physiol Rep 2017;5:e13537. [Crossref] [PubMed]
38. Posencheg MA, Gow AJ, Wang P, et al. Nitric Oxide and Cellular Maturity Are Key Components of Pro-Inflammatory Cytokine-Induced Apoptosis of Human Fetal Lung Epithelial Cells. Open Cell Dev Biol J 2011;3:1-5. [Crossref] [PubMed]
39. Tapia-Limonchi R, Cahuana GM, Caballano-Infantes E, et al. Nitric Oxide Prevents Mouse Embryonic Stem Cell Differentiation Through Regulation of Gene Expression, Cell Signaling, and Control of Cell Proliferation. J Cell Biochem 2016;117:2078-88. [Crossref] [PubMed]
40. Schmidt AR, Ramamoorthy C. Bronchopulmonary dysplasia. Paediatr Anaesth 2022;32:174-80. [Crossref] [PubMed]
41. Kraft VAN, Bezjian CT, Pfeiffer S, et al. GTP Cyclohydrolase 1/Tetrahydrobiopterin Counteract Ferroptosis through Lipid Remodeling. ACS Cent Sci 2020;6:41-53. [Crossref] [PubMed]
42. Xue J, Yu C, Sheng W, et al. The Nrf2/GCH1/BH4 Axis Ameliorates Radiation-Induced Skin Injury by Modulating the ROS Cascade. J Invest Dermatol 2017;137:2059-68. [Crossref] [PubMed]