Adrenal AKR1C3-mediated androgen activation contributes to hyperandrogenism in prepubertal ovariectomized rats
Highlight box
Key findings
• Prepubertal ovariectomy upregulates adrenal AKR1C3 as the most significantly differentially expressed gene (DEG), leading to enhanced conversion of androstenedione to testosterone. This was confirmed by in vitro overexpression and in vivo pharmacological inhibition, which dose-dependently reduced serum testosterone. Additionally, CYP17A1 showed post-transcriptional upregulation, and 11-ketotestosterone levels were elevated, indicating activation of both classical and 11-oxygenated androgen pathways.
What is known and what is new?
• AKR1C3 is a key enzyme that converts androstenedione to testosterone in peripheral tissues. In humans, its adrenal expression emerges during childhood and peaks at adrenarche, suggesting a role in developmental androgen regulation.
• This study provides the first evidence that prepubertal ovarian removal triggers adrenal AKR1C3 as the top DEG, directly driving systemic hyperandrogenism. It also reveals that CYP17A1 is post-transcriptionally upregulated during the prepubertal window and that 11-oxygenated androgens, such as 11-ketotestosterone, are elevated alongside classical androgens, establishing a mechanistic link between altered ovarian-adrenal crosstalk and adrenal hyperandrogenism.
What is the implication, and what should change now?
• These findings identify adrenal AKR1C3 as a potential therapeutic target for pediatric hyperandrogenic disorders, including premature adrenarche, polycystic ovary syndrome (PCOS), and congenital adrenal hyperplasia. The elevation of 11-ketotestosterone suggests that measuring this androgen may improve diagnostic evaluation in affected children. Future translational studies should validate these findings in human adrenal tissue and explore the clinical utility of AKR1C3 inhibitors. Prospective studies are also needed to determine whether 11-oxygenated androgen measurements enhance risk stratification in children with premature adrenarche or PCOS.
Introduction
Adrenarche is defined as the maturational increase of adrenal androgen production resulting from the development of the zona reticularis (1). This process is characterized by a rise in the secretion of adrenal androgens, primarily dehydroepiandrosterone (DHEA) and its sulfate ester (DHEAS) in humans. Although DHEA and DHEAS are weak androgens, they serve as key precursors for the synthesis of more potent androgens (1).
Premature adrenarche has been linked to precocious puberty in children. Dysregulation of adrenal steroidogenic enzymes—such as in 21-hydroxylase deficiency (21-OHD)—can disrupt androgen synthesis, leading to hyperandrogenism and disorders of sex development. Hyperandrogenemia contributes to various endocrine conditions, including polycystic ovary syndrome (PCOS), acne, and menstrual irregularities. The adrenal gland is a major source of androgens in humans and plays an important role in regulating puberty and growth.
In rodents, adrenal sex hormone synthesis remains controversial. While some studies suggest that rodents do not synthesize sex hormones in the adrenal glands, others report transient adrenarche maturation and elevated sex steroid production in rats. It is generally held that rat adrenals show minimal expression of CYP17, limiting their contribution to circulating androstenedione and DHEA (2). However, emerging evidence indicates that young female rats undergo an adrenarche-like process, with increases in adrenal-derived steroid precursors (3,4). A relative expansion of the zona reticularis has been observed around postnatal days (PNDs) 16–20 in rats, accompanied by peaks in androstenedione and 17-OH-progesterone—well before the onset of puberty on days 30–35 (3). Thus, whether the adrenal gland contributes significantly to steroid production in rats remains debated.
In this study, elevated androgen levels were detected in ovariectomized (OVX) rats, pointing to a possible adrenal source. This study aims to investigate adrenal androgen synthesis during the pre-pubertal period using a female rat ovariectomy model, thereby providing new insights into the regulatory mechanisms underlying this process. We present this article in accordance with the ARRIVE reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0288/rc).
Methods
Rats and samples
Sprague-Dawley rats were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and maintained under specific-pathogen-free conditions at Fudan University. On PND 15, half of the female pups from each litter were randomly assigned to undergo ovariectomy via a dorsal approach. Their remaining littermates served as sham-operated controls. Body weights were recorded daily from PND 20 to 30. Rats were euthanized on PND 20, 25, and 30 for tissue collection. Adrenal glands, blood serum, and uterine tissues were harvested. The wet weights of the adrenal glands and uterus were measured immediately after collection.
To pharmacologically inhibit AKR1C3, OVX juvenile rats received daily oral gavage of the AKR1C3 inhibitor ASP9521 (or vehicle) from PND 20 onward. ASP9521 was suspended in 0.5% carboxymethylcellulose sodium (CMC-Na) at concentrations of 0.1, 0.2, 0.3, and 0.4 mg/mL, corresponding to dose levels of 1, 2, 3, and 4 mg/kg, respectively. The gavage volume was administered at 10 mL/kg body weight.
Experiments were performed under a project license (approval No. [2023]222; approval date: 31 August 2023) granted by the Animal Ethics Committee of the Children’s Hospital of Fudan University, in compliance with national guidelines for the care and use of animals.
Reagents and antibodies
The following antibodies were used: anti-AKR1C3 (Affinity Biosciences, Changzhou, China, Cat# DF6613, RRID: AB_2838575), anti-Flag Tag (Affinity Biosciences, Cat# T0003, RRID: AB_2839412), and anti-CYP17A1 (Affinity Biosciences, Cat# AF5210, RRID: AB_2837696). Sodium carboxymethylcellulose (CMC-Na, CAS: 9004-32-4) was obtained from Sangon Biotech (Shanghai, China). Androstenedione (CAS: 63-05-8) was purchased from Solarbio (Beijing, China). The AKR1C3 inhibitor ASP9521 (CAS: 1126084-37-4) was acquired from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China).
RNA-sequencing
Adrenal gland transcriptomes from rats on PND 30 (N=3 per group) were analyzed by next-generation sequencing (Illumina NovaSeq 6000 platform; Novogene Biotech Co., Ltd., Beijing, China). The Rattus norvegicus reference genome assembly mRatBN7.2 (Ensembl release 110) was used for read alignment. Gene expression was quantified as FPKM (Fragments Per Kilobase of transcript per Million mapped reads). Differential expression analysis was performed with the DESeq2 R package (v1.20.0). Differentially expressed genes (DEGs) were identified using a threshold of adjusted P value (padj) < 0.05, calculated via the Benjamini-Hochberg procedure, and an absolute log2 fold change ≥1.
Assessment of serum hormone levels
Serum levels of testosterone (T), progesterone (P), estradiol (E2), adrenocorticotropic hormone (ACTH), luteinizing hormone (LH), and DHEA were measured using commercially available enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturers’ protocols (Elabscience Biotechnology Co., Wuhan, China, and Signalway Antibody, Nanjing, China).The following kits were used: LH (Cat# E-EL-R0026; sensitivity: 0.94 mIU/mL), T (Cat# E-OSEL-R0003; detection range, 0.16–10 ng/mL; sensitivity: 0.07 ng/mL), P (Cat# E-OSEL-R0007; range, 15.63–1,000 pg/mL; sensitivity: 7.01 pg/mL), E2 (Cat# E-OSEL-R0001; range, 3.13–200 pg/mL; sensitivity: 1.17 pg/mL), ACTH (Cat# E-EL-R0048; range, 15.63–1,000 pg/mL; sensitivity: 9.38 pg/mL), DHEA (Cat# EK10733; range, 0.05–10 ng/mL; sensitivity: 0.02 ng/mL).
All assays showed intra- and inter-assay coefficients of variation <10%, with high sensitivity and specificity for the respective rat hormones. No significant cross-reactivity or interference among the measured analytes was reported.
HEK293T cells culture and plasmid transfection
HEK293T cells (ATCC CRL-3216) were cultured in DMEM supplemented with 10% (v/v) fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (Invitrogen), and maintained at 37 ℃ in a humidified atmosphere with 5% CO2.
A pcDNA3.1 plasmid encoding RAT AKR1C3 with a C-terminal 3× FLAG tag was constructed by Suzhou Genewiz Biotechnology Co., Ltd. (Suzhou, China). HEK293T cells were transiently transfected with 2 µg of the plasmid using Lipofectamine™ 8000 Transfection Reagent (Beyotime, Shanghai, China, Cat# C0533). After 48 hours, the culture medium was replaced with fresh medium containing androstenedione at final concentrations of 0, 0.5, or 5 ng/mL, followed by incubation for an additional 24 hours (each condition in triplicate). AKR1C3-FLAG expression was confirmed by western blotting, and testosterone levels in the culture supernatant were measured by ELISA.
Quantitative real-time polymerase chain reaction (qPCR)
Total RNA was extracted from adrenal tissues using the SteadyPure Quick RNA Extraction Kit (Accurate Biotechnology, Changsha, China; Cat# AG21023) according to the manufacturer’s instructions. Equal amounts of RNA were reverse transcribed into cDNA. The expression levels of target genes were analyzed by qPCR with gene-specific primers (sequences are listed in Table 1).
Table 1
| Gene symbol | Primer-forward | Primer-reverse |
|---|---|---|
| GAPDH | GGTCGGTGTGAACGGATTTG | CACTTTGTCACAAGAGAAGGCA |
| AKR1C3 | GGTCAGGCCATTGTAAGCAA | CAACTCTGGACGATGGGAAG |
| CYP17A1 | GGCTTGGAGGTGATAAAGGG | AATCAGAATGTCCGTCAGGC |
Western blot
Total protein was extracted from adrenal tissues and HEK293T cells using RIPA lysis buffer, and protein concentration was determined with a bicinchoninic acid (BCA) assay kit. For western blotting, approximately 20 µg of protein per sample was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 5% non-fat milk and then incubated with the appropriate primary antibody at 4 ℃ overnight. Following primary antibody incubation, membranes were washed and incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit (Millipore, Billerica, MA, USA) and imaged with a chemiluminescence system. Band intensities were quantified densitometrically using ImageJ software (version 2.0.0). Uncropped images of all blots are provided in the Source Data file.
Immunohistochemistry (IHC)
IHC was performed on adrenal tissue sections using a Super Plus™ highly sensitive IHC kit (Elabscience, Cat# E-IR-R221, Wuhan, China). Briefly, deparaffinized and rehydrated sections were subjected to antigen retrieval by heating in boiled retrieval buffer for 15 min in a microwave. Endogenous peroxidase activity was blocked with the kit’s peroxidase blocking buffer (SP Reagent B). Sections were then incubated with primary antibody for 1 h at room temperature, followed by incubation with a polymer HRP-conjugated anti-rabbit/mouse IgG (SP Reagent C) for 30 min. Antigen-antibody complexes were visualized using a 3,3'-diaminobenzidine (DAB) substrate (SP Reagent D) for 45 s. Nuclei were counterstained with hematoxylin (SP Reagent F) for 5 min. For negative controls, the primary antibody was replaced with non-immune serum; all other steps were performed identically. All procedures were carried out under consistent conditions for every section.
Statistical analysis
The data were presented as the mean ± standard error (M ± SE). The grayscale values of the protein blots and histochemical staining were analyzed using ImageJ software. Statistical analyses were conducted using SPSS software (IBM Corporation, Armonk, NY, USA). Initially, the normality of the data distribution was assessed using a normality test and distribution curve. If the data were found to be normally distributed, Student’s t-test was used for the purpose of comparing two groups, and One-way analysis of variance (ANOVA) for the purpose of comparing multiple groups. However, if the data were found not to be normally distributed, the Mann-Whitney U test was utilized. Statistically significant findings were defined as those with a significance level of P<0.05.
Results
Increased wet weights of adrenal gland in OVX rats
No significant difference in body weight was observed between the two groups during the study period (Figure 1A). However, OVX rats exhibited increased adrenal gland wet weights compared with sham‑operated controls on PND25 (Figure 1B). In contrast, uterine weight was significantly reduced after ovariectomy (Figure 1C).
Hyperandrogenism after OVX during prepuberty
Serum level of 11‑keto testosterone (11‑KT) was elevated following ovariectomy (Figure 2A). T also increased (Figure 2B). In contrast, serum DHEA level decreased after ovariectomy (Figure 2C). P level additionally increased in OVX rats (Figure 2D). No statistically significant change was observed in serum androstenedione (∆4‑A) (Figure 2E) or ACTH (Figure 2F) between the two groups. E2 level also decreased in OVX rats (Figure 2G). Serum LH was significantly higher in OVX rats on PND30 (Figure 2H).
Adrenal AKR1C3 was increased after ovariectomy
RNA sequencing of adrenal tissues collected on PND30 revealed 115 significantly upregulated genes in OVX rats compared with sham-operated controls (Figure 3A; full gene list provided at https://cdn.amegroups.cn/static/public/supplementary-difference-gene-list.xlsx). The most DEG was AKR1C3 (Figure 3A), which participates in steroid hormone biosynthesis.
AKR1C3 (encoding aldoketo reductase family 1 member C3) was markedly elevated in adrenal tissues of OVX rats. This increase was confirmed at both the mRNA level by quantitative PCR (Figure 3B) and the protein level by western blotting (Figure 3C). Furthermore, immunohistochemical staining showed stronger AKR1C3 immunoreactivity in the adrenal glands of OVX rats on PND25 and PND30 (Figure 3D).
AKR1C3 converts androstenedione to testosterone in vitro
After 24 hours of androstenedione (∆4‑A) supplementation, HEK293T cells expressing AKR1C3 produced significantly higher levels of testosterone compared with controls, demonstrating the enzyme’s catalytic activity in converting androstenedione to testosterone (Figure 4A). These cells were obtained by transient transfection with a pcDNA3.1 plasmid encoding AKR1C3 (Figure 4B).
Pharmacological inhibition of AKR1C3 reduces serum testosterone in OVX rats
Consistent with previous findings, serum testosterone levels were significantly higher in OVX rats than in sham-operated controls. Daily administration of the AKR1C3 inhibitor ASP9521 attenuated this increase in a dose-dependent manner, with the most pronounced suppression observed at a dose of 2 mg/kg/day (Figure 5A). In contrast, serum testosterone levels in sham-operated rats showed no significant change following ASP9521 administration (Figure 5B).
CYP17A1 expression exhibits post-transcriptional upregulation after ovariectomy
CYP17A1 mRNA levels declined from PND20 to PND30 in both OVX and sham-operated rats (Figure 6A). In contrast, CYP17A1 protein expression was significantly higher in OVX rats than in controls on PND30, as shown by western blotting (Figure 6B) and IHC (Figure 6C).
Discussion
Our findings indicate that AKR1C3 and CYP17A1 are differentially regulated in adrenal tissues after pre‑pubertal ovariectomy.
AKR1C3 (also termed type 5, 17βhydroxysteroid dehydrogenase) is involved in adrenal steroid metabolism in humans (5). In human adrenal glands, AKR1C3 immunoreactivity is detectable from approximately 9 to 20 years of age (6). This enzyme primarily catalyzes the conversion of androstenedione (Δ4A) to testosterone in peripheral tissues (7). Recent studies indicate that AKR1C3 also catalyzes the reduction of DHEA to androstenediol, a key precursor for testosterone synthesis (8,9). Paulukinas et al. demonstrated that AKR1C3 also catalyzes the conversion of 11oxygenated androgens into potent androgens in a PCOS adipocyte model (10). Notably, adrenal‑derived 11oxygenated androgen precursors are reported to be preferred substrates for AKR1C3 over androstenedione (11). Consistent with these observations, the present study demonstrates that elevated adrenal AKR1C3 expression is correlated with increased levels of testosterone and 11‑ketotestosterone (11KT). Moreover, administration of an AKR1C3 inhibitor suppresses the elevated androgen levels in pre‑pubertal OVX rats, thereby supporting the hypothesis that adrenal AKR1C3 plays a key role in androgen activation in OVX rats.
CYP17A1 is a key bifunctional enzyme in steroidogenesis, catalyzing both 17α‑hydroxylase and 17,20lyase reactions essential for converting pregnenolone to DHEA (12). In humans, it is primarily expressed in the adrenal cortex, especially in the zona reticularis, where it drives DHEA production. In rodents, however, its role remains debated. Although some reports indicate that Cyp17a1 is suppressed in adult rodent adrenals and contributes little to circulating androstenedione or DHEA (2,13), Pignatelli et al. observed a transient peak in adrenal Cyp17a1 mRNA around PNDs 16–20, accompanied by peaks in circulating androstenedione and 17‑OHprogesterone before gonadal maturation (3). Consistent with this developmental pattern, our study detected abundant CYP17A1 protein in adrenal glands around PND 20. This suggests that adrenal CYP17A1 is functionally active during the pre‑pubertal period in rats. The apparent discrepancy with earlier reports may stem from the age of animals examined; studies describing minimal CYP17A1 activity typically used older (e.g., 20‑week‑old or pregnant) rats, whereas our data highlight a developmentally restricted window of adrenal CYP17A1 expression and function prior to puberty.
Previous work has shown that bilateral ovariectomy in adults reduces adrenal cortex activity in both women and rodents, likely due to altered ovarian humoral feedback on the hypothalamic-pituitary-adrenal axis (14-17). In adult female rats, OVX was also reported to elevate hepatic AKR1C3 (18). Our findings extend this understanding by demonstrating that OVX performed before puberty enhances the adrenal expression of key steroidogenic enzymes (AKR1C3 and CYP17A1), thereby promoting adrenal androgen synthesis during the prepubertal period. The observation that OVX is associated with adrenal upregulation of AKR1C3 and CYP17A1 suggests that ovarian-derived signals may normally restrain adrenal androgen synthesis.
First, loss of ovarian inhibitory signals likely plays a central role. Serum E2 was markedly reduced after OVX (Figure 2G), and estrogen receptors (ERα and ERβ) are expressed in the adrenal cortex (19). Estrogen has been reported to suppress adrenal androgen production in both human and rodent models, partly through downregulation of CYP17A1 and AKR1C3 (20,21). Thus, reduced estrogen signaling may relieve tonic inhibition on adrenal steroidogenesis. In addition, inhibin B produced by the prepubertal ovary may regulate adrenal steroidogenesis via endocrine or paracrine pathways (22,23). Loss of these peptide signals may further promote adrenal enzyme upregulation. Second, elevated gonadotropins may provide an additional stimulatory input to the adrenal gland. Following OVX, serum LH levels were significantly increased on PND30 (Figure 2H). Although the adrenal cortex has traditionally not been considered a classical LH-responsive tissue, functional LH/hCG receptors have been identified in the adrenal zona reticularis (24). Emerging clinical evidence shows that pharmacological suppression of gonadotropins using Gonadotropin-releasing hormone (GnRH) agonists or antagonists reduces circulating adrenal androgens (DHEA-S and androstenedione) (25,26), supporting a functional LH-adrenal axis. Thus, elevated LH after OVX may contribute to adrenal AKR1C3/CYP17A1 upregulation and increased androgen synthesis. Third, the increased CYP17A1 protein expression despite transcriptional regulation (Figure 6) suggests that post-transcriptional mechanisms may also be involved, including altered mRNA stability, translation efficiency, or protein turnover. Collectively, these findings support a model in which prepubertal OVX enhances adrenal AKR1C3 and CYP17A1 expression through combined loss of ovarian inhibitory signals, gonadotropin-mediated stimulation, and post-transcriptional regulation. However, the precise molecular pathways remain to be fully elucidated. Future studies using selective hormone replacement and tissue-specific genetic approaches will be required to dissect the relative contribution of each pathway.
An unexpected finding in this study was the elevated LH on PND30 in OVX rats despite persistently high testosterone and progesterone levels (Figure 2B,2D,2H). Under classical negative feedback regulation, elevated sex steroids would be expected to suppress LH secretion. The sustained LH elevation therefore suggests an altered sensitivity of the hypothalamic-pituitary axis to steroid feedback following ovarian removal. This may be related, in part, to the loss of non-steroidal ovarian factors (e.g., inhibins) that normally contribute to fine-tuning of gonadotropic feedback signaling (27), as well as the relative immaturity of the prepubertal hypothalamic-pituitary-gonadal axis, which may require a higher steroid threshold to achieve effective suppression (28). In addition, accumulating evidence indicates a bidirectional interaction between androgen excess and gonadotropin secretion. In conditions such as PCOS, hyperandrogenism is frequently associated with increased LH secretion (29). Mechanistically, androgens can modulate the activity of hypothalamic KNDy (kisspeptin/neurokinin B/dynorphin) neurons, which constitute the GnRH pulse generator, thereby altering GnRH pulsatility and promoting LH hypersecretion (30). Androgens may also impair steroid negative feedback at the hypothalamic level, further contributing to sustained LH elevation (31). In the present OVX model, we propose that adrenal-derived androgen excess may participate in sustaining elevated LH via mechanisms analogous to those described in PCOS, thereby forming a potential feed-forward loop between adrenal androgen production and gonadotropin secretion. In this study, we identified adrenal AKR1C3 as a key mediator of prepubertal androgen synthesis. Elevated serum testosterone levels, which often precede early female puberty, are associated with an increased risk of obesity, insulin resistance, and potentially PCOS (1). Notably, weight gain is recognized as a trigger for adrenarche (32), and obesity is linked to a higher incidence of premature adrenarche (33). Taken together, these observations raise the important question of whether AKR1C3 also contributes to the hyperandrogenism characteristic of obesity and PCOS, warranting further investigation.
Conclusions
This study demonstrates that pre‑pubertal ovariectomy upregulates adrenal AKR1C3 and CYP17A1 expression in female rats, leading to increased adrenal testosterone synthesis. These findings provide novel insight into the adrenal response to ovarian removal before puberty and highlight the functional role of AKR1C3 and CYP17A1 in activating adrenal androgen production in this model.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0288/rc
Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0288/dss
Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0288/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0288/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Experiments were performed under a project license (approval No. [2023]222; approval date: 31 August 2023) granted by the Animal Ethics Committee of the Children’s Hospital of Fudan University, in compliance with national guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Rosenfield RL. Normal and Premature Adrenarche. Endocr Rev 2021;42:783-814. [Crossref] [PubMed]
- Cumberland AL, Hirst JJ, Badoer E, et al. The Enigma of the Adrenarche: Identifying the Early Life Mechanisms and Possible Role in Postnatal Brain Development. Int J Mol Sci 2021;22:4296. [Crossref] [PubMed]
- Pignatelli D, Xiao F, Gouveia AM, et al. Adrenarche in the rat. J Endocrinol 2006;191:301-8. [Crossref] [PubMed]
- Li H, Liu Y, Meng F, et al. Adrenarche-accompanied rise of adrenal sex steroid precursors prevents NAFLD in Young Female rats by converting into active androgens and inactivating hepatic Srebf1 signaling. BMC Genomics 2024;25:190. [Crossref] [PubMed]
- Nakamura Y, Hornsby PJ, Casson P, et al. Type 5 17beta-hydroxysteroid dehydrogenase (AKR1C3) contributes to testosterone production in the adrenal reticularis. J Clin Endocrinol Metab 2009;94:2192-8. [Crossref] [PubMed]
- Hui XG, Akahira J, Suzuki T, et al. Development of the human adrenal zona reticularis: morphometric and immunohistochemical studies from birth to adolescence. J Endocrinol 2009;203:241-52. [Crossref] [PubMed]
- Penning TM, Wangtrakuldee P, Auchus RJ. Structural and Functional Biology of Aldo-Keto Reductase Steroid-Transforming Enzymes. Endocr Rev 2019;40:447-75. [Crossref] [PubMed]
- Detlefsen AJ, Mesaros CA, Duan L, et al. AKR1C3 Converts Castrate and Post-Abiraterone DHEA-S into Testosterone to Stimulate Growth of Prostate Cancer Cells via 5-Androstene-3β,17β-Diol. Cancer Res Commun 2023;3:1888-98. [Crossref] [PubMed]
- Penning TM. Aldo-Keto Reductase (AKR) 1C3 inhibitors: a patent review. Expert Opin Ther Pat 2017;27:1329-40. [Crossref] [PubMed]
- Paulukinas RD, Mesaros CA, Penning TM. Conversion of Classical and 11-Oxygenated Androgens by Insulin-Induced AKR1C3 in a Model of Human PCOS Adipocytes. Endocrinology 2022;163:bqac068. [Crossref] [PubMed]
- Barnard M, Quanson JL, Mostaghel E, et al. 11-Oxygenated androgen precursors are the preferred substrates for aldo-keto reductase 1C3 (AKR1C3): Implications for castration resistant prostate cancer. J Steroid Biochem Mol Biol 2018;183:192-201. [Crossref] [PubMed]
- Miller WL, Auchus RJ. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr Rev 2011;32:81-151. [Crossref] [PubMed]
- Ohtsuki Y, Fujiki J, Maeda N, et al. Enhanced expression of Cyp17a1 and production of DHEA-S in the liver of late-pregnant rats. Gen Comp Endocrinol 2025;362:114661. [Crossref] [PubMed]
- Chen Y, Xu D, Xia X, et al. Sex difference in adrenal developmental toxicity induced by dexamethasone and its intrauterine programming mechanism. Pharmacol Res 2021;174:105942. [Crossref] [PubMed]
- Chen W, Meng F, Zeng X, et al. Mechanic Insight into the Distinct and Common Roles of Ovariectomy Versus Adrenalectomy on Adipose Tissue Remodeling in Female Mice. Int J Mol Sci 2023;24:2308. [Crossref] [PubMed]
- Ding Y, Liu G, Zeng F, et al. Adrenal gland responses surgical castration and immunocastration by different compensatory manners to increase DHEA secretion. Anim Biotechnol 2023;34:966-73. [Crossref] [PubMed]
- Du X, He X, Liu Q, et al. Comparative Transcriptomics Reveals the Key lncRNA and mRNA of Sunite Sheep Adrenal Gland Affecting Seasonal Reproduction. Front Vet Sci 2022;9:816241. [Crossref] [PubMed]
- Yoon S, Lee J, Lee SM. Combined treatment of isoflavone supplementation and exercise restores the changes in hepatic protein expression in ovariectomized rats - a proteomics approach. J Int Soc Sports Nutr 2014;11:29. [Crossref] [PubMed]
- Pacwa A, Gorowska-Wojtowicz E, Ptak A, et al. Interplay between estrogen-related receptors and steroidogenesis-controlling molecules in adrenals. In vivo and in vitro study. Acta Histochem 2018;120:456-67. [Crossref] [PubMed]
- Taniguchi F, Couse JF, Rodriguez KF, et al. Estrogen receptor-alpha mediates an intraovarian negative feedback loop on thecal cell steroidogenesis via modulation of Cyp17a1 (cytochrome P450, steroid 17alpha-hydroxylase/17,20 lyase) expression. FASEB J 2007;21:586-95. [Crossref] [PubMed]
- Imamichi Y, Sekiguchi T, Kitano T, et al. Diethylstilbestrol administration inhibits theca cell androgen and granulosa cell estrogen production in immature rat ovary. Sci Rep 2017;7:8374. [Crossref] [PubMed]
- Hofland J, de Jong FH. Inhibins and activins: their roles in the adrenal gland and the development of adrenocortical tumors. Mol Cell Endocrinol 2012;359:92-100. [Crossref] [PubMed]
- Vänttinen T, Liu J, Kuulasmaa T, et al. Expression of activin/inhibin signaling components in the human adrenal gland and the effects of activins and inhibins on adrenocortical steroidogenesis and apoptosis. J Endocrinol 2003;178:479-89. [Crossref] [PubMed]
- Rao CV. Human adrenal LH/hCG receptors and what they could mean for adrenal physiology and pathology. Mol Cell Endocrinol 2010;329:33-6. [Crossref] [PubMed]
- Nishii M, Nomura M, Sekine Y, et al. Luteinizing hormone (LH)-releasing hormone agonist reduces serum adrenal androgen levels in prostate cancer patients: implications for the effect of LH on the adrenal glands. J Androl 2012;33:1233-8. [Crossref] [PubMed]
- Miyazawa Y, Sekine Y, Syuto T, et al. A gonadotropin-releasing hormone antagonist reduces serum adrenal androgen levels in prostate cancer patients. BMC Urol 2017;17:70. [Crossref] [PubMed]
- Goodman RL, Herbison AE, Lehman MN, et al. Neuroendocrine control of gonadotropin-releasing hormone: Pulsatile and surge modes of secretion. J Neuroendocrinol 2022;34:e13094. [Crossref] [PubMed]
- Hill JW, Elias CF. Neuroanatomical Framework of the Metabolic Control of Reproduction. Physiol Rev 2018;98:2349-80. [Crossref] [PubMed]
- Moore AM. Neuroendocrine mechanisms responsible for elevated gonadotrophin-releasing hormone and luteinising hormone pulses in polycystic ovary syndrome. J Neuroendocrinol 2025;37:e70028. [Crossref] [PubMed]
- Siddiqui S, Mateen S, Ahmad R, et al. A brief insight into the etiology, genetics, and immunology of polycystic ovarian syndrome (PCOS). J Assist Reprod Genet 2022;39:2439-73. [Crossref] [PubMed]
- Tfayli H, Arslanian S, Witchel SF. POLYCYSTIC OVARY SYNDROME: ORIGINS AND IMPLICATIONS: PCOS in adolescents: ontogeny of neuroendocrine and metabolic disturbances. Reproduction 2025;170:e250115. [Crossref] [PubMed]
- Kaya G, Yavas Abali Z, Bas F, et al. Body mass index at the presentation of premature adrenarche is associated with components of metabolic syndrome at puberty. Eur J Pediatr 2018;177:1593-601. [Crossref] [PubMed]
- Esquivel-Zuniga MR, Kirschner CK, McCartney CR, et al. Non-PCOS Hyperandrogenic Disorders in Adolescents. Semin Reprod Med 2022;40:42-52. [Crossref] [PubMed]

