Stage-associated differences in injury and stress responses of hiPSC-derived cardiomyocytes under macrophage-derived inflammatory stimulation
Original Article

Stage-associated differences in injury and stress responses of hiPSC-derived cardiomyocytes under macrophage-derived inflammatory stimulation

Wei Jing1, Qingbin Liu2, Xiaoyi Chang2, Yuna Zhang3, Jing Li1

1Department of Pediatric Internal Medicine IV, Affiliated Hospital of Changchun University of Chinese Medicine, Changchun, China; 2Pediatric Intensive Care Unit, Affiliated Hospital of Changchun University of Chinese Medicine, Changchun, China; 3Infection Control Office, Affiliated Hospital of Changchun University of Chinese Medicine, Changchun, China

Contributions: (I) Conception and design: W Jing; (II) Administrative support: W Jing; (III) Provision of study materials or patients: Q Liu, X Chang; (IV) Collection and assembly of data: Y Zhang, J Li; (V) Data analysis and interpretation: Q Liu, X Chang, Y Zhang, J Li; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Wei Jing, MM. Department of Pediatric Internal Medicine IV, Affiliated Hospital of Changchun University of Chinese Medicine, No. 1478 Gongnongda Road, Changchun 130021, China. Email: 13844827128@163.com.

Background: Macrophage-driven inflammation contributes to myocardial injury in pediatric myocarditis, but the extent to which cardiomyocyte maturation status influences responses to inflammatory stimulation remains unclear. This study aimed to investigate stage-associated differences in human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) exposed to THP-1 macrophage-derived conditioned media and to explore the involvement of stress-response pathways.

Methods: A macrophage-derived inflammatory microenvironment was modeled using THP-1-derived macrophage conditioned media (M0-CM and M1-CM). hiPSC-CMs at day 7 (D7) and day 21 (D21) were used as early-stage and relatively more mature in vitro stages, respectively. Cell viability was assessed using Cell Counting Kit-8 (CCK-8), and lactate dehydrogenase (LDH) release and cardiac troponin I (cTnI) levels were measured to evaluate injury. C/EBP homologous protein (CHOP) expression was analyzed by Western blot, and mitochondrial membrane potential (ΔΨm) was determined using tetraethylbenzimidazolylcarbocyanine iodide (JC-1) staining following small interfering RNA (siRNA)-mediated CHOP knockdown.

Results: M1-CM significantly increased tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) levels compared with M0 and control groups (P<0.001), along with upregulation of inducible nitric oxide synthase (iNOS) (P<0.001). Under inflammatory stimulation, D7 hiPSC-CMs showed greater decreases in viability and greater LDH and cTnI release than D21 hiPSC-CMs in the stage-stratified analyses. CHOP expression was induced by M1-CM (P<0.001), and CHOP knockdown decreased LDH release (P<0.001) and partially restored ΔΨm (P<0.05).

Conclusions: Early-stage hiPSC-CMs showed greater vulnerability to THP-1 macrophage-derived inflammatory stimulation than relatively more mature D21 cells in this in vitro model. CHOP-associated endoplasmic reticulum (ER) stress contributed partly to mitochondrial dysfunction, but this system does not fully recapitulate pediatric myocarditis and requires validation in more physiologically complex models.

Keywords: Pediatric myocarditis; human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs); immune microenvironment; C/EBP homologous protein (CHOP); mitochondrial dysfunction


Submitted May 21, 2026. Accepted for publication Jul 08, 2026. Published online Aug 27, 2026.

doi: 10.21037/tp-2026-0505


Highlight box

Key findings

• Early-stage day 7 human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) showed greater injury and stress responses than relatively more mature day 21 cells under THP-1 macrophage-derived inflammatory stimulation; C/EBP homologous protein knockdown partially attenuated lactate dehydrogenase release and mitochondrial depolarization in D7 cells.

What is known and what is new?

• Macrophage-associated inflammation and endoplasmic reticulum stress are implicated in myocarditis-related myocardial injury.

• This study adds stage-stratified hiPSC-CM evidence suggesting that maturation status may influence vulnerability to macrophage-derived inflammatory stimulation, while emphasizing the limitations of the simplified in vitro model.

What is the implication, and what should change now?

• These findings support further validation of maturation-dependent inflammatory vulnerability in patient-derived immune-cell, viral-stimulation, co-culture, and more mature hiPSC-CM systems; they do not yet support direct clinical changes.


Introduction

Pediatric myocarditis is a clinically significant inflammatory disease characterized by myocardial injury triggered by immune activation (1). In affected patients, cardiac dysfunction can develop rapidly, and in severe cases may progress to heart failure or even sudden death (2). Although viral infection and subsequent immune responses are widely recognized as key drivers, the mechanisms underlying cardiomyocyte vulnerability remain incompletelyunderstood (3). Notably, children often exhibit more variable and sometimes more severe clinical manifestations compared with adults, suggesting that intrinsic cellular properties, rather than external triggers alone, may influence disease progression (4).

Recent studies have begun to focus on the role of the immune microenvironment in myocardial injury (5). Activated immune cells, particularly macrophages, release pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), which can directly impair cardiomyocyte function and viability (6). In vitro models using conditioned media from polarized macrophages provide a controllable system to study inflammatory injury, although they do not reproduce the full cellular, viral, and patient-specific context of myocarditis (7). At the same time, human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as a valuable platform for studying cardiac pathophysiology, as they retain key human-specific features and allow staged maturation (8). However, most existing studies tend to treat hiPSC-CMs as a uniform population, while the impact of their maturation status on injury response is often overlooked (9).

One important but insufficiently explored question is whether early-stage or less mature cardiomyocytes are intrinsically more susceptible to immune-mediated damage. Pediatric myocardium differs from adult myocardium in developmental and disease-related features, but short-term hiPSC-CM culture stages should not be considered direct surrogates for pediatric versus adult myocardium (10).Although some evidence suggests that less mature cells have altered metabolic profiles and stress responses, direct experimental validation under defined inflammatory conditions remains limited (11). In addition, the molecular pathways linking inflammatory stimulation to cellular injury, particularly those involving endoplasmic reticulum (ER) stress and mitochondrial dysfunction (12), have not been clearly delineated in the context of cardiomyocyte maturation-stage differences.

In the present study, a controlled macrophage-derived inflammatory stimulation system was established using THP-1-derived macrophage conditioned media. hiPSC-CMs at day 7 and day 21 were used as early-stage and relatively more mature in vitro phenotypes, respectively, rather than as direct equivalents of pediatric and adult myocardium. By comparing injury-related indicators such as cardiac troponin I (cTnI), lactate dehydrogenase (LDH) release, and cell viability, this study aimed to evaluate whether maturation stage is associated with susceptibility to inflammatory injury. In addition, the role of the ER stress-related protein C/EBP homologous protein (CHOP) and its association with mitochondrial dysfunction were further explored. We present this article in accordance with the MDAR reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0505/rc).


Methods

Preparation of macrophage conditioned media

The human monocytic cell line THP-1 (SCSP-567, Cell Bank of the Chinese Academy of Sciences, Shanghai, China) was maintained at 37 °C with 5% CO2 in RPMI-1640 medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Before supernatant collection, all groups were switched to RPMI-1640 supplemented with 1% FBS and incubated for 24 h.The collected media were then centrifuged and passed through a 0.22 µm filter (Millipore, Burlington, MA, USA).

Cells were divided into three groups (13-15). The Control group (G1) was cultured without induction. For G2 and G3, THP-1 cells were first treated with phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St. Louis, MO, USA,5 ng/mL) for 24 h, followed by recovery in complete medium for 72 h. Subsequently, cells in the M0 group (G2) were left without further stimulation, whereas those in the M1 group (G3) were exposed to interferon-γ (IFN-γ; PeproTech, Rocky Hill, NJ, USA, 20 ng/mL) and lipopolysaccharide (LPS; Sigma-Aldrich, 250 ng/mL) for24 h. Conditioned media were then collected and designated as control-CM, M0-CM, and M1-CM.

Cardiomyocyte maturation stratification, immune microenvironment stimulation, and CHOP intervention

hiPSC-CMs (iCell Cardiomyocytes2, Fujifilm Cellular Dynamics, Madison, WI, USA) were thawed and seeded according to the manufacturer’s instructions in maintenance medium (Cellular Dynamics, Madison, WI, USA). Cells were cultured under standard conditions (37 °C, 5% CO2), and medium was replaced every 2–3 days.

Maturation stratification of hiPSC-derived cardiomyocytes

To establish maturation-stage stratification, cells from the same batch were maintained for different durations after plating. Cardiomyocytes cultured for 7 days post-thaw were defined as the early-stage group (D7, G4), while those maintained for 21 days were defined as the relatively more mature in vitro group (D21, G5) (16,17). These two stages were used for subsequent comparative experiments, without implying that D21 hiPSC-CMs had reached adult cardiomyocyte maturity.

Maturation status was evaluated using α-actinin immunofluorescence and quantitative real-time polymerase chain reaction (qRT-PCR) analysis of TNNI3 and ATP2A2. Because electrophysiology, calcium transients, contractility, metabolic profiling, mitochondrial content, and adult-like sarcomere organization were not assessed, the D21 group was described as relatively more mature rather than fully mature.

Immune microenvironment stimulation in D7 cardiomyocytes

hiPSC-CMs at day 7 were assigned into three groups. In the vehicle group (G6), cells were cultured in a mixed medium consisting of 50% RPMI-1640 with 1% FBS and 50% cardiomyocyte maintenance medium. Conditioned media were applied at a 1:1 ratio (50% CM + 50% cardiomyocyte maintenance medium), with G7 and G8 receiving M0-CM and M1-CM, respectively, for 24 h.

Immune microenvironment stimulation in D21 cardiomyocytes

A similar design was applied to cardiomyocytes at day 21. Cells were divided into three groups. The vehicle group (G9) was maintained in the same mixed medium as described above without conditioned media. Cells in the M0-CM group (G10) and M1-CM group (G11) were treated with a 1:1 mixture of conditioned medium and cardiomyocyte maintenance medium (50% M0-CM or M1-CM + 50% medium), respectively, for 24 h, after which cells and supernatants were collected (18).

CHOP knockdown and functional intervention

For mechanistic validation, hiPSC-CMs at day 7 were subjected to siRNA transfection. Cells were transfected with either negative control siRNA (si-NC) or CHOP-targeting siRNA (si-CHOP) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol, with a transfection duration of 24–48 h.

Following transfection, cells were assigned into four groups. The vehicle + si-NC group (G12) was maintained in a mixed medium consisting of 50% RPMI-1640 with 1% FBS and 50% cardiomyocyte maintenance medium. The M1-CM group (G13) received a 1:1 mixture of M1-CM and cardiomyocyte maintenance medium without transfection. In parallel, cells in G14 and G15 were treated with the same mixture (50% M1-CM + 50% cardiomyocyte maintenance medium) after transfection with si-NC or si-CHOP, respectively, and incubated for 24 h before analysis (19).

Enzyme-linked immunosorbent assay (ELISA)

After treatment, culture supernatants from all groups (G1–G3, G6–G8, G9–G11) were collected and clarified by centrifugation (1,000 × g, 20 min) at 4 °C, followed by immediate use for ELISA detection.

TNF-α and IL-6 levels in THP-1-derived conditioned media (G1–G3) were measured using ELISA kits (TNF-α, Cat# YJ-10119; IL-6, Cat# YJ-10205; Jiangsu Enzyme Immunoassay Co., China, Yancheng, China). Supernatants from G6–G8 and G9–G11 were analyzed for cTnI using a human cTnI ELISA kit (Cat# E-EL-H0065c, Sangon Biotech, Shanghai, China), and cTnI concentrations were normalized to the corresponding total protein content of each well.

Assays were performed according to the respective manufacturer’s protocols. Briefly, samples or standards were added to pre-coated plates, followed by incubation at 37 °C, washing, enzyme conjugation, and chromogenic development. Absorbance was measured at 450 nm (BioTek Synergy HTX, Winooski, VT, USA), and concentrations were calculated from standard curves with dilution factors applied when necessary.

Western blot analysis

Protein expression was analyzed in THP-1 cells (G1–G3) and hiPSC-CMs (G12–G15) by Western blot. Following treatment, cells were harvested and lysed on ice using RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with PMSF (1 mM, Beyotime). After centrifugation (12,000 × g, 10 min, 4 °C), supernatants containing total protein were collected for further analysis.

Protein concentrations were determined using a bicinchoninic acid (BCA) assay kit (Beyotime), after which equal amounts of protein (approximately 30 µg) were denatured and separated by SDS-PAGE. The separated proteins were then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore), followed by blocking with 5% non-fat milk at room temperature.

Primary antibody incubation was performed overnight at 4 °C, targeting CD68 (Cat# ab303565, Abcam, 1:1,000), inducible nitric oxide synthase (iNOS; Cat# ab178945, Abcam, 1:1,000), CHOP (Cat# BM4962, Boster, 1:2,000), and β-actin (Cat# 81115-1-RR, Proteintech, 1:10,000). After washing, membranes were incubated with HRP-conjugated goat anti-rabbit IgG secondary antibody (Cat# bs-0295G-HRP, BIOSS, Woburn, MA, 1:3,000) at room temperature.

Signal detection was carried out using enhanced chemiluminescence (ECL) substrate (Millipore), and images were captured with a chemiluminescence imaging system (Sage Creation, Beijing, China). Band intensities were quantified using ImageJ software (NIH, Bethesda, MD, USA) and normalized to β-actin.

Immunofluorescence staining

Cardiomyocytes (G4–G5) were subjected to immunofluorescence staining to assess sarcomeric structure. Following culture, cells grown on coverslips were first rinsed with phosphate-buffered saline (PBS; Cat# G0002, Google Biotechnology, Wuhan, China) and then fixed with 4% paraformaldehyde (Cat# G1101-500ML, Servicebio, Wuhan, China) for 20 min at room temperature. Permeabilization was subsequently performed using a permeabilization buffer (Cat# G1204-100ML, Servicebio) for 20 min, after which nonspecific binding was minimized by incubation with 3% bovine serum albumin (BSA; Cat# A8020, Solarbio, Beijing, China). Primary antibody against α-actinin (Cat# ET1706-05, HuaAn Biotechnology, Hangzhou, China) was then applied and incubated overnight at 4 °C.

After washing, FITC-conjugated secondary antibody (goat anti-rabbit IgG, Cat# GB22303, Servicebio) was added and allowed to react at room temperature. Nuclear staining was carried out using DAPI solution (Cat# G1012-10ML, Servicebio) under light-protected conditions, followed by mounting with anti-fade medium. Image acquisition was performed using a fluorescence microscope (Nikon Eclipse Ti-SR, Tokyo, Japan), with excitation/emission settings adjusted for DAPI and FITC channels. Sarcomeric organization was evaluated based on α-actinin distribution and structural continuity.

qRT-PCR

Prior to amplification, total RNA was isolated from cells (G4–G5) using a FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China), with concentration and purity evaluated before reverse transcription. cDNA synthesis was subsequently carried out using HisyGo All-in-One RT Red SuperMix for qRT-PCR (Cat# RT333-01, Vazyme) under standard reaction conditions.

Using the obtained cDNA as template, amplification reactions were prepared in a 20 µL system with SupRealQ Ultra Hunter SYBR qRT-PCR Master Mix (U+) (Cat# Q713-02, Vazyme), into which gene-specific primers for cardiac troponin I (TNNI3) and sarco/endoplasmic reticulum Ca2+-ATPase 2 (ATP2A2) were introduced (Table 1). Thermal cycling was performed with an initial denaturation at 95 °C, followed by 40 amplification cycles and a final melting curve stage.

Table 1

Primer sequences used for qRT-PCR

Gene Direction Sequence (5'–3')
TNNI3 Forward TTGCAAAGCAAGAGCTGGAG
Reverse CTCGAAGGTCAAAGATCTTCTG
ATP2A2 Forward GATTACAATGAGGCAAAGGGTG
Reverse TTTGACTCCAGAGGTCATAGG

qRT-PCR, quantitative real-time polymerase chain reaction.

Relative expression levels, after normalization to an internal control, were calculated using the 2−ΔΔCt method, rather than being derived directly from raw Ct values.

Cell Counting Kit-8 (CCK-8) assay

After treatment, cells (G6–G11) seeded in 96-well plates were maintained under standard culture conditions, with medium conditions corresponding to each experimental group. Prior to detection, 10 µL of CCK-8 solution (Cat# C0038, Beyotime) was directly added to each well containing 100 µL culture medium, followed by incubation at 37 °C for 2 h, avoiding bubble formation that may interfere with optical readings. Absorbance was then measured at 450 nm using a microplate reader (BioTek Synergy HTX), from which relative cell viability was calculated after background subtraction. Values were normalized to the control group, rather than being interpreted from raw absorbance alone, to reflect treatment-induced changes more accurately.

LDH assay

Cell injury was further assessed by measuring LDH release in culture supernatants from hiPSC-CMs (G6–G15) using a total LDH assay kit based on the WST-8 method (Cat# C0016, Beyotime). Following treatment, supernatants were collected directly or after brief centrifugation when necessary, and subsequently subjected to enzymatic reaction.

For detection, samples were first mixed with assay buffer to a defined volume, after which WST-8 working solution was added to initiate the reaction; absorbance at 450 nm was recorded immediately (baseline) and again after incubation at 37 °C for 30 min, allowing LDH activity to be derived from the change in optical density (ΔA). LDH release was quantified according to the manufacturer’s instructions and normalized to the corresponding total protein content of each well.

JC-1 mitochondrial membrane potential (ΔΨm) assay

Following treatment, cells (G12–G15) were incubated with JC-1 working solution (Servicebio) under light-protected conditions at 37 °C, allowing potential-dependent accumulation of the dye within mitochondria, after which excess probe was removed by washing. Fluorescence signals were then captured, and ΔΨm was assessed based on the ratio of red (aggregated JC-1) to green (monomeric JC-1) fluorescence rather than absolute intensity.

A decrease in red/green fluorescence ratio was interpreted as mitochondrial depolarization, whereas maintenance of red fluorescence indicated preserved membrane potential, enabling functional comparison across experimental groups.

Statistical analysis

All data were analyzed using SPSS software (version 23.0; IBM Corp., USA). Results are presented as mean ± standard deviation (SD). For all assays, n=3 denotes biological replicates from independently prepared wells or cultures within the same experimental workflow; technical readings, when obtained, were averaged before statistical analysis. Prior to analysis, data distribution and variance homogeneity were assessed, based on which comparisons within each experimental set were performed using one-way analysis of variance (ANOVA) followed by appropriate post hoc tests. Because the present dataset was analyzed as stage-stratified D7 and D21 experiments and was not designed for a prespecified two-way maturation stage × treatment interaction model, between-stage findings were interpreted as stage-associated differences rather than definitive proof of a statistical interaction. A two-tailed P value <0.05 was considered statistically significant.


Results

Generation and validation of a THP-1-derived pro-inflammatory macrophage conditioned-medium model

To characterize the macrophage-derived inflammatory stimulus, cytokine secretion and phenotype-related protein expression were first assessed. ELISA results showed that TNF-α and IL-6 levels were markedly elevated in the M1 group compared with the M0 group, while no significant difference was observed between M0 and Control (Figure 1A, P<0.001). Western blot analysis demonstrated increased CD68 expression in both M0 and M1 groups, which was interpreted as a macrophage differentiation/activation marker, and upregulation of iNOS in the M1 group, which was interpreted as an M1-associated inflammatory marker (Figure 1B,1C, P<0.001).

Figure 1 THP-1-derived pro-inflammatory macrophage conditioned-medium model. (A) TNF-α and IL-6 levels by ELISA. (B,C) CD68 and iNOS protein expression and corresponding quantitative analysis by Western blot. CD68 was used as a macrophage differentiation/activation marker, whereas iNOS was used as an M1-associated inflammatory marker. Data are presented as mean ± standard deviation (n=3 biological replicates). ***, P<0.001 vs. control; ###, P<0.001 vs. M0. iNOS, inducible nitric oxide synthase; THP-1, human monocytic leukemia cell line; TNF-α, tumor necrosis factor-α.

Together, these findings indicate that M1-CM generated a reproducible THP-1 macrophage-derived pro-inflammatory stimulus for subsequent experiments. This system was interpreted as an in vitro inflammatory injury model rather than a complete pediatric myocarditis model.

Stage-associated structural and molecular stratification of hiPSC-CMs (D7 vs. D21)

Following confirmation of a reproducible inflammatory stimulus in the preceding section, we next examined whether hiPSC-CMs exhibited stage-associated structural and molecular differences. Immunofluorescence staining demonstrated that cells at D7 displayed relatively sparse and discontinuous sarcomeric organization, whereas those cultured to D21 showed more aligned and better-defined striations (Figure 2A, P<0.001 or P<0.01), consistent with a relatively more mature structural phenotype over time.

Figure 2 Structural and molecular characterization of D7 and relatively more mature D21 hiPSC-derived cardiomyocytes. (A) Sarcomeric organization assessed by immunofluorescence staining. (B) mRNA expression levels of TNNI3 and ATP2A2 by qRT-PCR. Data are presented as mean ± standard deviation (n=3 biological replicates). **, P<0.01, ***, P<0.001 vs. hiPSC-CMs (D7). hiPSC-CMs, human induced pluripotent stem cell-derived cardiomyocytes; qRT-PCR, quantitative real-time polymerase chain reaction.

Building on these morphological observations, gene expression analysis was subsequently performed to further validate maturation status. qRT-PCR results revealed that the expression levels of cardiac troponin I (TNNI3) and sarco/endoplasmic reticulum Ca2+-ATPase 2 (ATP2A2) were significantly higher in D21 cells compared with D7 cells (Figure 2B), consistent with enhanced contractile and calcium-handling capacity.

Taken together, the structural and transcriptional findings support the use of D7 and D21 hiPSC-CMs as distinct in vitro maturation stages for subsequent comparison of injury susceptibility under inflammatory stimulation, while not establishing adult-like cardiomyocyte maturity.

Early-stage D7 hiPSC-CMs exhibit exacerbated injury under macrophage-derived inflammatory stimulation

Having established maturation stratification, we next investigated how immature cardiomyocytes respond to inflammatory stimulation. CCK-8 analysis showed a stepwise decline in cell viability from vehicle to M0-CM and further to M1-CM (Figure 3A, P<0.01 or P<0.001), indicating that inflammatory cues progressively impair cellular activity in D7 cardiomyocytes. Consistent with this trend, LDH release was significantly increased under CM stimulation, with the highest levels observed in the M1-CM group (Figure 3B, P<0.01 or P<0.001), reflecting aggravated membrane damage.

Figure 3 Injury responses of early-stage D7 hiPSC-derived cardiomyocytes under macrophage-derived inflammatory stimulation. (A) Cell viability assessed by CCK-8 assay. (B) Total protein-normalized LDH release measured by LDH assay kit. (C) Total protein-normalized cTnI release detected by ELISA. Data are presented as mean ± standard deviation (n=3 biological replicates). **, P<0.01 vs. vehicle; ###, P<0.001 vs. M0-CM. CCK-8, Cell Counting Kit-8; CMs, cardiomyocytes; cTnI, cardiac troponin I; ELISA, enzyme-linked immunosorbent assay; hiPSC, human induced pluripotent stem cell; LDH, lactate dehydrogenase.

To further corroborate these findings, myocardial injury was assessed at the protein level. ELISA results demonstrated that cTnI levels were markedly elevated following exposure to conditioned media, with a more pronounced increase in the M1-CM group compared with M0-CM (Figure 3C, P<0.01 or P<0.001), aligning with the observed decline in viability and increase in LDH.

Collectively, these results indicate that D7 hiPSC-CMs exhibit amplified injury responses under macrophage-derived inflammatory stimulation, particularly in the presence of M1-associated factors.

Relatively more mature D21 hiPSC-CMs exhibit attenuated injury responses to macrophage-derived inflammatory stimulation

Given the heightened susceptibility observed in D7 hiPSC-CMs, we next assessed whether D21 cells exhibited a different response pattern under the same inflammatory conditions. In contrast to D7 cells, CCK-8 analysis showed a milder reduction in cell viability across Vehicle, M0-CM, and M1-CM groups (Figure 4A, P<0.01 or P<0.001), suggesting relatively preserved cellular activity in D21 hiPSC-CMs. Consistently, although LDH release increased upon CM stimulation, the magnitude of change appeared attenuated compared with D7 cells in the stage-stratified analyses (Figure 4B, P<0.001).

Figure 4 Injury responses of relatively more mature D21 hiPSC-derived cardiomyocytes under macrophage-derived inflammatory stimulation. (A) Cell viability assessed by CCK-8 assay. (B) Total protein-normalized LDH release measured by LDH assay kit. (C) Total protein-normalized cTnI release detected by ELISA. Data are presented as mean ± standard deviation (n=3 biological replicates). *, P<0.05; **, P<0.01; ***, P<0.001 vs. vehicle; ##, P<0.01; ###, P<0.001 vs. M0-CM. CCK-8, Cell Counting Kit-8; CMs, cardiomyocytes; cTnI, cardiac troponin I; ELISA, enzyme-linked immunosorbent assay; hiPSC, human induced pluripotent stem cell; LDH, lactate dehydrogenase.

At the level of myocardial injury markers, ELISA results demonstrated that cTnI levels were elevated following exposure to conditioned media; however, the overall increase remained less pronounced than that observed in D7 cells (Figure 4C, P<0.05), indicating a reduced extent of injury.

Taken together, these findings suggest that D21 hiPSC-CMs display comparatively attenuated injury responses to macrophage-derived inflammatory stimulation, supporting stage-associated differences in injury susceptibility.

CHOP knockdown partially attenuates stress imbalance and mitochondrial depolarization in early-stage D7 hiPSC-CMs

Building on the differential susceptibility observed in immature cardiomyocytes, we next explored whether targeting ER stress could mitigate injury under inflammatory stimulation. LDH analysis showed that M1-CM exposure significantly increased cytotoxicity, which was not altered by si-NC transfection but was markedly reduced upon CHOP knockdown (Figure 5A, P<0.001), indicating partial restoration of membrane integrity. Consistently, Western blot results demonstrated a pronounced upregulation of CHOP in response to M1-CM, while si-CHOP effectively suppressed its expression, as confirmed by quantitative analysis (Figure 5B, P<0.001).

Figure 5 Effects of CHOP knockdown on injury and mitochondrial function in early-stage D7 hiPSC-derived cardiomyocytes. (A) Total protein-normalized LDH release measured by LDH assay kit. (B) CHOP protein expression and quantitative analysis by Western blot. (C) Mitochondrial membrane potential assessed by JC-1 staining. (D) Quantitative analysis of red/green fluorescence ratio. Data are presented as mean ± standard deviation (n=3 biological replicates). ***, P<0.001 vs. vehicle + si-NC; ##, P<0.01; ###, P<0.001 vs. M1-CM + si-NC. CMs, cardiomyocytes; hiPSC, human induced pluripotent stem cell; LDH, lactate dehydrogenase.

Given the central role of mitochondrial dysfunction in stress responses, JC-1 staining was further performed. A clear shift from red to green fluorescence was observed in M1-CM-treated cells, reflecting mitochondrial depolarization, whereas this change was notably reversed following CHOP silencing (Figure 5C); quantitative analysis of the red/green fluorescence ratio further supported these observations (Figure 5D, P<0.001 or P<0.05).

Collectively, these findings suggest that CHOP-associated ER stress contributes to mitochondrial dysfunction and cellular injury in early-stage D7 hiPSC-CMs, and that CHOP inhibition partially restores cellular homeostasis under inflammatory conditions. These data support CHOP as one contributing node rather than proving it to be the central mediator of injury.


Discussion

The present study provides in vitro evidence that hiPSC-CMs at different culture stages respond differently to macrophage-derived inflammatory stimulation, with three main observations emerging. First, THP-1-derived M1-CM generated a pro-inflammatory macrophage-derived stimulus characterized by elevated TNF-α and IL-6 and enhanced iNOS expression, but this system should be interpreted as a simplified inflammatory injury model rather than a full pediatric myocarditis model. Second, early-stage D7 hiPSC-CMs showed greater susceptibility to injury, as evidenced by reduced viability and increased LDH and cTnI release, whereas D21 cells showed a more attenuated response in stage-stratified analyses. Third, CHOP knockdown partially reversed injury phenotypes in D7 cells and improved mitochondrial membrane potential, linking ER stress-associated signaling to mitochondrial dysfunction in this context. Together, these findings support a hypothesis-generating model in which cardiomyocyte maturation stage may shape vulnerability to inflammatory injury, with CHOP acting as one functional contributor.

The impact of the immune microenvironment on cardiomyocyte injury has been widely recognized, particularly in myocarditis where macrophage activation plays an important role (6). In this study, the use of THP-1-derived conditioned media allowed controlled inflammatory stimulation, avoiding variability inherent to patient-derived samples. The observed increase in TNF-α and IL-6 in M1-CM is consistent with prior reports showing that polarized macrophages secrete pro-inflammatory cytokines that impair cardiomyocyte contractility and survival (20). At the same time, the upregulation of iNOS supports an M1-associated inflammatory phenotype linked to nitric oxide overproduction and oxidative stress (21). However, CD68 is a general macrophage differentiation/activation marker rather than an M1-specific marker, and M1-CM may contain multiple cytokines, metabolites, residual IFN-γ/LPS, and serum-related factors. Therefore, the present model should be viewed as a standardized macrophage-derived inflammatory stimulus rather than proof of a myocarditis-specific immune microenvironment.

Against this background, the difference between D7 and D21 hiPSC-CMs is informative but should be interpreted cautiously. While both groups responded to inflammatory stimulation, the magnitude of injury appeared higher in D7 cells. This pattern aligns with previous observations that early-stage hiPSC-CMs exhibit incomplete structural organization and immature calcium-handling features, making them less capable of maintaining homeostasis under stress (21). Studies using hiPSC-CMs have shown that maturation is accompanied by improved sarcomeric alignment and enhanced expression of contractile and calcium-regulatory proteins, which contribute to functional stability (22). In the present study, higher TNNI3 and ATP2A2 expression in D21 cells parallels these reports and provides molecular support for a relatively more mature phenotype. Nevertheless, D21 hiPSC-CMs remain developmentally immature compared with adult cardiomyocytes, and additional electrophysiological, calcium-transient, contractility, metabolic, mitochondrial-content, and adult-like sarcomere assessments would be required for a more robust maturation validation.

The involvement of CHOP adds a mechanistic layer that connects these observations. As a downstream effector of ER stress, CHOP has been implicated in various forms of cardiac injury, including ischemia-reperfusion and inflammatory damage (23). Here, its upregulation under M1-CM stimulation and subsequent reduction following siRNA-mediated knockdown indicate that CHOP-associated ER stress is engaged in D7 hiPSC-CMs exposed to inflammatory cues. This modulation was accompanied by changes in mitochondrial membrane potential, as reflected by JC-1 staining. Such coupling between ER stress and mitochondrial dysfunction has been described in other systems, where CHOP can influence mitochondrial permeability and apoptotic signaling (24). In this study, the partial restoration of ΔΨm upon CHOP inhibition suggests that ER stress may contribute to mitochondrial depolarization, although the exact signaling intermediates remain to be clarified. Because additional ER stress markers and apoptosis markers were not assessed, CHOP should be interpreted as a contributing mediator rather than the sole or central mediator of injury.

From a broader perspective, these findings may help frame hypotheses regarding clinical heterogeneity in pediatric myocarditis. Pediatric and adult myocardium differ in developmental and disease-related characteristics, but the current D7/D21 hiPSC-CM model cannot directly represent pediatric versus adult myocardium. Rather, the data suggest that maturation-stage-associated cellular features may influence the magnitude of inflammatory injury under controlled in vitro conditions. While caution is needed in extrapolating these findings to clinical settings, the concept of a developmental vulnerability window remains worthy of further investigation in patient-derived immune-cell systems, viral stimulation models, primary macrophage co-cultures, and longer-term maturation platforms.

Several limitations should be acknowledged. First, the use of THP-1-derived conditioned media, while reproducible, does not fully capture the complexity of pediatric myocarditis, where patient-derived immune cells, viral triggers, primary macrophages, cardiomyocyte-immune cell contact, and dynamic multicellular interactions may be involved. Residual IFN-γ/LPS, cytokines beyond TNF-α and IL-6, metabolites, and serum-related factors in M1-CM may also have contributed to the observed responses, and separate LPS/IFN-γ-only controls were not included. Second, the maturation of hiPSC-CMs in vitro, even at D21, remains incomplete compared with adult cardiomyocytes. The current maturation validation relied on α-actinin organization and TNNI3/ATP2A2 expression; electrophysiology, calcium transients, contractility, metabolic profiling, mitochondrial content, and adult-like sarcomere organization were not assessed. Third, the sample size was limited because the study was conducted within a restricted in vitro system, and independent hiPSC lines or independent differentiations were not included. Therefore, the statistical findings should be interpreted cautiously and require further validation in larger and more independent experimental systems. A formal two-way maturation stage × treatment interaction analysis was not performed; therefore, stage-related conclusions should be interpreted as exploratory. Fourth, CHOP knockdown provided functional evidence of involvement but did not establish CHOP as the central mediator. Additional ER stress markers, including GRP78/BiP, PERK, p-eIF2α, ATF4, ATF6, and IRE1α/XBP1, apoptosis markers such as cleaved caspase-3, Bax/Bcl-2, and TUNEL, and expanded macrophage polarization markers including CD80, CD86, HLA-DR, IL-1β, CXCL10, CD206, and ARG1 should be incorporated in future studies.

In summary, this study suggests that hiPSC-CM maturation stage is associated with differential susceptibility to THP-1 macrophage-derived inflammatory injury, with D7 cells showing amplified damage and stress responses compared with D21 cells in stage-stratified analyses. The data further suggest that CHOP-associated ER stress contributes partly to mitochondrial dysfunction in this setting. These findings provide a hypothesis-generating framework linking in vitro maturation stage, inflammatory stimulation, and cellular injury, while requiring validation in more disease-relevant myocarditis models.


Conclusions

This study suggests that maturation-stage-associated features of hiPSC-derived cardiomyocytes influence their responses to THP-1 macrophage-derived inflammatory stimulation, with early-stage D7 cells exhibiting more pronounced damage, impaired viability, and heightened stress responses than relatively more mature D21 cells in this in vitro model. Mechanistically, CHOP-associated endoplasmic reticulum stress appears to contribute partly to this vulnerability by promoting mitochondrial dysfunction, as indicated by partial restoration of mitochondrial membrane potential following CHOP inhibition. These findings should be interpreted as hypothesis-generating evidence relevant to inflammatory myocardial injury and pediatric myocarditis research, rather than as direct proof from a complete disease model.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0505/rc

Data Sharing Statement: Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0505/dss

Peer Review File: Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0505/prf

Funding: This study was supported by Translational Research Project of Affiliated Hospital of Changchun University of Chinese Medicine (No. KYSR-2025-083).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0505/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Hutchinson Z, Law Y. Myocarditis in children: diagnosis and management. JHLT Open 2025;10:100332. [Crossref] [PubMed]
  2. Alamri AS, Khayat LT, Alzahrani AJ, et al. Clinical Presentation of Myocarditis in the Pediatric Age Group and Predictors of Poor Early and Late Outcomes: Academic Hospital Experience. Cureus 2022;14:e31643. [Crossref] [PubMed]
  3. Ling I, Aponte Alburquerque RA, Steed AL. Pediatric viral myocarditis: mechanisms, experimental models, and research gaps. Pediatr Res 2026; Epub ahead of print. [Crossref]
  4. Ricci JC, Farahani NA, Davis CJ, et al. A comparative review of myocarditis in pediatrics versus adults: pathogenesis, diagnosis, and management. Front Immunol 2025;16:1601307. [Crossref] [PubMed]
  5. Tschöpe C, Ammirati E, Bozkurt B, et al. Myocarditis and inflammatory cardiomyopathy: current evidence and future directions. Nat Rev Cardiol 2021;18:169-93. [Crossref] [PubMed]
  6. Yang P, Chen Z, Huang W, et al. Communications between macrophages and cardiomyocytes. Cell Commun Signal 2023;21:206. [Crossref] [PubMed]
  7. Parisi L, Bianchi MG, Ghezzi B, et al. Preparation of human primary macrophages to study the polarization from monocyte-derived macrophages to pro- or anti-inflammatory macrophages at biomaterial interface in vitro. J Dent Sci 2023;18:1630-7. [Crossref] [PubMed]
  8. Stephanie GA, Vander Roest AS. Cardiac disease mechanobiology: advances using hiPSC-CMs. Front Cardiovasc Med 2025;12:1642931. [Crossref] [PubMed]
  9. Veerman CC, Kosmidis G, Mummery CL, et al. Immaturity of human stem-cell-derived cardiomyocytes in culture: fatal flaw or soluble problem? Stem Cells Dev 2015;24:1035-52. [Crossref] [PubMed]
  10. Patel MD, Mohan J, Schneider C, et al. Pediatric and adult dilated cardiomyopathy represent distinct pathological entities. JCI Insight 2017;2:e94382. [Crossref] [PubMed]
  11. Correia C, Koshkin A, Duarte P, et al. Distinct carbon sources affect structural and functional maturation of cardiomyocytes derived from human pluripotent stem cells. Sci Rep 2017;7:8590. [Crossref] [PubMed]
  12. Bronner DN, Abuaita BH, Chen X, et al. Endoplasmic Reticulum Stress Activates the Inflammasome via NLRP3- and Caspase-2-Driven Mitochondrial Damage. Immunity 2015;43:451-62. [Crossref] [PubMed]
  13. Baxter EW, Graham AE, Re NA, et al. Standardized protocols for differentiation of THP-1 cells to macrophages with distinct M(IFNγ+LPS), M(IL-4) and M(IL-10) phenotypes. J Immunol Methods 2020;478:112721. [Crossref] [PubMed]
  14. Lund ME, To J, O’Brien BA, et al. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J Immunol Methods 2016;430:64-70. [Crossref] [PubMed]
  15. Daigneault M, Preston JA, Marriott HM, et al. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS One 2010;5:e8668. [Crossref] [PubMed]
  16. Lundy SD, Zhu WZ, Regnier M, et al. Structural and functional maturation of cardiomyocytes derived from human pluripotent stem cells. Stem Cells Dev 2013;22:1991-2002. [Crossref] [PubMed]
  17. Knight WE, Cao Y, Lin YH, et al. Maturation of Pluripotent Stem Cell-Derived Cardiomyocytes Enables Modeling of Human Hypertrophic Cardiomyopathy. Stem Cell Reports 2021;16:519-33. [Crossref] [PubMed]
  18. Ma C, Liu S, Zhao Y, et al. DANCR promotes septic cardiomyopathy by enhancing macrophage glycolytic reprogramming via the IGF2BP2/HK2 axis. Front Cell Dev Biol 2025;13:1628915. [Crossref] [PubMed]
  19. Han K, Hassanzadeh S, Singh K, et al. Parkin regulation of CHOP modulates susceptibility to cardiac endoplasmic reticulum stress. Sci Rep 2017;7:2093. [Crossref] [PubMed]
  20. Dick SA, Epelman S. Chronic Heart Failure and Inflammation: What Do We Really Know? Circ Res 2016;119:159-76. [Crossref] [PubMed]
  21. Fetterman KA, Blancard M, Lyra-Leite DM, et al. Independent compartmentalization of functional, metabolic, and transcriptional maturation of hiPSC-derived cardiomyocytes. Cell Rep 2024;43:114160. [Crossref] [PubMed]
  22. Huebsch N, Charrez B, Neiman G, et al. Metabolically driven maturation of human-induced-pluripotent-stem-cell-derived cardiac microtissues on microfluidic chips. Nat Biomed Eng 2022;6:372-88. [Crossref] [PubMed]
  23. Tian G, Li J, Zhou L. Ginsenoside Rg1 regulates autophagy and endoplasmic reticulum stress via the AMPK/mTOR and PERK/ATF4/CHOP pathways to alleviate alcohol‑induced myocardial injury. Int J Mol Med 2023;52:56. [Crossref] [PubMed]
  24. Jiang Z, Wen X, Mao Q, et al. 13-Methylpalmatine improves myocardial infarction injury by inhibiting CHOP-mediated cross-talk between endoplasmic reticulum and mitochondria. Biomed Pharmacother 2024;179:117342. [Crossref] [PubMed]
Cite this article as: Jing W, Liu Q, Chang X, Zhang Y, Li J. Stage-associated differences in injury and stress responses of hiPSC-derived cardiomyocytes under macrophage-derived inflammatory stimulation. Transl Pediatr 2026;15(8):301. doi: 10.21037/tp-2026-0505

Download Citation